Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19039
Trapped Gene
Ccdc124 (ENSMUSG00000007721)
Vector Insertion
Chr 8: 73393007 - 73393803
Public Clones (ggtc)
Private Clones OST406549 (lexicon) OST224822 (lexicon) OST191848 (lexicon) OST59659 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224057 (Chr8:73393804..73393973 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224057 (Chr8:73393804..73393973 -)
Downstram Exon
ENSMUSE00000224053 (Chr8:73392832..73393006 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224065 Chr8:73397358..73397389 No primer for this exon
upstream ENSMUSE00000224057 Chr8:73393804..73393973 No primer for this exon

*** Putative Vector Insertion (Chr 8: 73393007 - 73393803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224053 Chr8:73392832..73393006 No primer for this exon
downstream ENSMUSE00000213492 Chr8:73392636..73392750 No primer for this exon
downstream ENSMUSE00000224042 Chr8:73392127..73392544 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGACAAACACGTGATGC Chr8:73393819..73393839 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGACAAACACGTGATGC Chr8:73393819..73393839 60.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGGGTCCTAGTCACAGTCCA Chr8:73393998..73394019 60.02 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGGGTCCTAGTCACAGTCCA Chr8:73393998..73394019 60.02 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007721