Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19043
Trapped Gene
G3bp2 (ENSMUSG00000029405)
Vector Insertion
Chr 5: 92494881 - 92495517
Public Clones not available
Private Clones OST406452 (lexicon) OST289910 (lexicon) OST284320 (lexicon) OST233456 (lexicon)
OST9117 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323144 (Chr5:92495518..92495608 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323144 (Chr5:92495518..92495608 -)
Downstram Exon
ENSMUSE00000188545 (Chr5:92494778..92494880 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTTGCACAGGTTCAGGAGA Chr5:92494795..92494814 59.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513954 Chr5:92512555..92512684 No primer for this exon
upstream ENSMUSE00000188561 Chr5:92502186..92502304 AAGCTCCCGAGTATTTGCAC Chr5:92502188..92502207 59.34 50
upstream ENSMUSE00000188551 Chr5:92499383..92499464 TGTTCATGGTGGAGTGGATG Chr5:92499421..92499440 60.38 50
upstream ENSMUSE00000188547 Chr5:92497351..92497524 GTGGACAGCCTGAGAGGAAG Chr5:92497381..92497400 59.99 60
upstream ENSMUSE00000323144 Chr5:92495518..92495608 No primer for this exon

*** Putative Vector Insertion (Chr 5: 92494881 - 92495517) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188545 Chr5:92494778..92494880 TCTTGCACAGGTTCAGGAGA Chr5:92494795..92494814 59.54 50
downstream ENSMUSE00000188556 Chr5:92493351..92493531 AGGCTCAGGTTCATGAGAGG Chr5:92493461..92493480 59.4 55
downstream ENSMUSE00000188546 Chr5:92492363..92492461 CACTGAAGCCCAGGAGAAAG Chr5:92492419..92492438 59.98 55
downstream ENSMUSE00000188558 Chr5:92486994..92487096 TGGCTGAGACTGAACTTCTGG Chr5:92487036..92487056 60.57 52.38
downstream ENSMUSE00000323118 Chr5:92485295..92485423 TTCTCCGGTTGTCAGAGTCA Chr5:92485360..92485379 59.39 50
downstream ENSMUSE00000323110 Chr5:92484410..92484528 TTGGTATTGATGCGAAGTTCC Chr5:92484470..92484490 59.95 42.86
downstream ENSMUSE00000597268 Chr5:92483540..92484079 GTCACGATCACGCATCATTC Chr5:92483884..92483903 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGAAGGGAGCTGCTCAGTA Chr5:92495485..92495506 59.63 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCTCGTGACTGGGAAAA Chr5:92495452..92495472 58.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029405