Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19051
Trapped Gene
Stt3b (ENSMUSG00000032437)
Vector Insertion
Chr 9: 115189638 - 115218869
Public Clones not available
Private Clones OST406142 (lexicon) OST325639 (lexicon) OST325637 (lexicon) OST218444 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388138 (Chr9:115218870..115219586 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGTCGTCCCTCAACTCGT Chr9:115219123..115219142 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388138 (Chr9:115218870..115219586 -)
Downstram Exon
ENSMUSE00000219753 (Chr9:115189529..115189637 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGTCGTCCCTCAACTCGT Chr9:115219123..115219142 60.3 55 TTCTTCCCAGTGGGTACCAT Chr9:115189521..115189540 59.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388138 Chr9:115218870..115219586 CAAGTCGTCCCTCAACTCGT Chr9:115219123..115219142 60.3 55

*** Putative Vector Insertion (Chr 9: 115189638 - 115218869) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219753 Chr9:115189529..115189637 TTCTTCCCAGTGGGTACCAT Chr9:115189521..115189540 59.26 50
downstream ENSMUSE00000219744 Chr9:115185822..115186109 TGAACTGAAGCGCAAAAATG Chr9:115185814..115185833 59.99 40
downstream ENSMUSE00000219751 Chr9:115176428..115176493 GACCCGGTCTTCACAGACTT Chr9:115176449..115176468 59.15 55
downstream ENSMUSE00000219737 Chr9:115175212..115175311 ACACATGGAGAGGGATGAGG Chr9:115175235..115175254 59.92 55
downstream ENSMUSE00000219749 Chr9:115167580..115167678 TGTGCTCGCTTGTTCTGATT Chr9:115167570..115167589 59.6 45
downstream ENSMUSE00000219750 Chr9:115166554..115166700 AAAGCGTAAGCTTGCAGCAG Chr9:115166648..115166667 60.84 50
downstream ENSMUSE00000219755 Chr9:115165251..115165299 TGAATAAAACCTGCCACTCCA Chr9:115165243..115165263 60.49 42.86
downstream ENSMUSE00000434524 Chr9:115163907..115164061 AAGACACCCATGTCGTAGGC Chr9:115163972..115163991 60 55
downstream ENSMUSE00000219748 Chr9:115162951..115163162 TTTCATGTCATCCCCCAAAT Chr9:115163001..115163020 59.99 40
downstream ENSMUSE00000219743 Chr9:115161617..115161804 AAGGACCACACTTGGACTGG Chr9:115161615..115161634 60 55
downstream ENSMUSE00000219735 Chr9:115160796..115160967 CGTGTTCATCCGTGTTTTGT Chr9:115160878..115160897 59.47 45
downstream ENSMUSE00000219746 Chr9:115159897..115160070 TTGATATCGTCCCCGGAATA Chr9:115159930..115159949 60.11 45
downstream ENSMUSE00000219741 Chr9:115157623..115157736 CTCCCTGCTGGGTGAAATAG Chr9:115157687..115157706 59.69 55
downstream ENSMUSE00000434494 Chr9:115155163..115155375 CTTCTGTTTGGGGACGATGT Chr9:115155156..115155175 59.97 50
downstream ENSMUSE00000519384 Chr9:115152921..115153163 TTAACGTAGCCACGCTTCCT Chr9:115153113..115153132 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATAATCGCCTTGCAGCAC Chr9:115215801..115215822 59.76 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTAGACAGAGGGCCTGA Chr9:115206847..115206867 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032437