Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19062
Trapped Gene
Ftsj1 (ENSMUSG00000031171)
Vector Insertion
Chr X: 7817957 - 7822185
Public Clones IST10793A11 (tigm) IST11459E4 (tigm) IST10793A11 (tigm) IST12966E11 (tigm)
IST11459E4 (tigm) IST10343H1 (tigm) IST13731G12 (tigm) IST15067H4 (tigm)
IST12479E12 (tigm) IST15067H4 (tigm) IST13346G10 (tigm) IST12966E11 (tigm)
IST13901H7 (tigm) IST10343H1 (tigm)
Private Clones OST405859 (lexicon) OST29650 (lexicon) OST19985 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207058 (ChrX:7822186..7822227 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207058 (ChrX:7822186..7822227 -)
Downstram Exon
ENSMUSE00000703519 (ChrX:7817546..7817956 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAATTCCTGGGCCTTCTAGG ChrX:7817674..7817693 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000383729 ChrX:7829298..7829532 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703517 ChrX:7829298..7829436 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000703521 ChrX:7829298..7829521 GTCCACTCCGAACACCAACT ChrX:7829372..7829391 60.01 55
upstream ENSMUSE00000239660 ChrX:7828006..7828163 ACTGAGATGGGACGGACATC ChrX:7828113..7828132 59.93 55
upstream ENSMUSE00000239653 ChrX:7827695..7827764 No primer for this exon
upstream ENSMUSE00000207056 ChrX:7827522..7827612 TACAGGGCGACATCACTCAG ChrX:7827522..7827541 59.85 55
upstream ENSMUSE00000239642 ChrX:7826105..7826183 CCAAGGAGATCATCCAGCAC ChrX:7826154..7826173 60.62 55
upstream ENSMUSE00000207055 ChrX:7823995..7824047 TGGTCTCCATGATGTGGATG ChrX:7824024..7824043 60.34 50
upstream ENSMUSE00000207066 ChrX:7823853..7823906 No primer for this exon
upstream ENSMUSE00000207064 ChrX:7823658..7823760 GGGATGTGACCCTGCTCTAC ChrX:7823728..7823747 59.53 60
upstream ENSMUSE00000207063 ChrX:7823462..7823545 GCTTCATTCCAGACCTGACC ChrX:7823487..7823506 59.66 55
upstream ENSMUSE00000207062 ChrX:7822678..7822781 TCGGACCGCACTTACTCTCT ChrX:7822682..7822701 60.01 55
upstream ENSMUSE00000703520 ChrX:7822678..7822775 TCGGACCGCACTTACTCTCT ChrX:7822682..7822701 60.01 55
upstream ENSMUSE00000343131 ChrX:7822410..7822598 CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45
upstream ENSMUSE00000703516 ChrX:7822410..7822556 CCAAGAATGCTCCATCAACA ChrX:7822463..7822482 59.65 45
upstream ENSMUSE00000207058 ChrX:7822186..7822227 No primer for this exon

*** Putative Vector Insertion (Chr X: 7817957 - 7822185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703519 ChrX:7817546..7817956 GAATTCCTGGGCCTTCTAGG ChrX:7817674..7817693 60.03 55
downstream ENSMUSE00000422171 ChrX:7815794..7817956 TTCAGGCATTTCTTGCTCCT ChrX:7815786..7815805 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGCAGGTGGAAGACAAT ChrX:7822214..7822234 60.49 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGGTGGAAGACAATGAA ChrX:7819211..7819231 61.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCTTTGGCAGGTGGAAGAC ChrX:7819217..7819237 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTTTGGCAGGTGGAAGAC ChrX:7819217..7819237 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031171