Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19071
Trapped Gene
AC132406.4-201 (ENSMUSG00000074284)
Vector Insertion
Chr 9: 56905609 - 56919415
Public Clones not available
Private Clones OST405509 (lexicon) OST391617 (lexicon) OST355794 (lexicon) OST263182 (lexicon)
OST239654 (lexicon) OST230645 (lexicon) OST216592 (lexicon) OST85813 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636632 (Chr9:56919416..56919614 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATGGCCCTACCACTTGGAC Chr9:56919475..56919494 59.81 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636632 (Chr9:56919416..56919614 -)
Downstram Exon
ENSMUSE00000636631 (Chr9:56905076..56905608 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATGGCCCTACCACTTGGAC Chr9:56919475..56919494 59.81 55 TGCCAAGAATCAGTGCAGAC Chr9:56905366..56905385 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636632 Chr9:56919416..56919614 TATGGCCCTACCACTTGGAC Chr9:56919475..56919494 59.81 55

*** Putative Vector Insertion (Chr 9: 56905609 - 56919415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636631 Chr9:56905076..56905608 TGCCAAGAATCAGTGCAGAC Chr9:56905366..56905385 59.99 50
downstream ENSMUSE00000636635 Chr9:56904709..56904945 GTGCGCTAAAGCCTATCCTG Chr9:56904733..56904752 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAAACGTGTAATCGCCTTGC Chr9:56916352..56916373 60.14 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGGGTTTTGCGTGACTGG Chr9:56907355..56907375 60.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074284