Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19086
Trapped Gene
Rhov (ENSMUSG00000034226)
Vector Insertion
Chr 2: 119096224 - 119096417
Public Clones not available
Private Clones OST405139 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306656 (Chr2:119096418..119096476 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCGAGCTTTGGGACACC Chr2:119096427..119096446 61.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306656 (Chr2:119096418..119096476 -)
Downstram Exon
ENSMUSE00000378013 (Chr2:119094939..119096223 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCGAGCTTTGGGACACC Chr2:119096427..119096446 61.94 55 GCCATAGCTGCTCACACAAA Chr2:119095747..119095766 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412166 Chr2:119096652..119096965 CAGCCTCATCGTCAGCTACA Chr2:119096706..119096725 60.16 55
upstream ENSMUSE00000306656 Chr2:119096418..119096476 GAATCGAGCTTTGGGACACC Chr2:119096427..119096446 61.94 55

*** Putative Vector Insertion (Chr 2: 119096224 - 119096417) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378013 Chr2:119094939..119096223 GCCATAGCTGCTCACACAAA Chr2:119095747..119095766 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGGGTGTAGCCTTCCTT Chr2:119096390..119096410 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGGGTGTAGCCTTCCTT Chr2:119096390..119096410 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034226