Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19095
Trapped Gene
Lgr4 (ENSMUSG00000050199)
Vector Insertion
Chr 2: 109848823 - 109851407
Public Clones not available
Private Clones OST404885 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315414 (Chr2:109848739..109848822 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315414 (Chr2:109848739..109848822 +)
Downstram Exon
ENSMUSE00000476247 (Chr2:109851408..109854412 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCTGTCCGAGACAAAGGAA Chr2:109852589..109852608 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686433 Chr2:109757804..109758462 CAACCAGGGTGTTTGTGAGA Chr2:109757854..109757873 59.56 50
upstream ENSMUSE00000376695 Chr2:109810849..109810920 No primer for this exon
upstream ENSMUSE00000315583 Chr2:109829862..109829933 TGGCTGGTAACGACCTTTCT Chr2:109829867..109829886 59.73 50
upstream ENSMUSE00000315577 Chr2:109831261..109831332 AGTGAAGCCATTCGTGGACT Chr2:109831295..109831314 59.73 50
upstream ENSMUSE00000315571 Chr2:109836711..109836926 GACTTCGCATTCACCAACCT Chr2:109836889..109836908 60.12 50
upstream ENSMUSE00000315564 Chr2:109837750..109837821 No primer for this exon
upstream ENSMUSE00000315555 Chr2:109839563..109839631 CCCTTCCCAGCCTTAAAGAG Chr2:109839610..109839629 60.19 55
upstream ENSMUSE00000315550 Chr2:109840453..109840524 TTCTGTTATCCCGGATGGAG Chr2:109840474..109840493 59.89 50
upstream ENSMUSE00000315544 Chr2:109840717..109840788 TCTTTTGTGGGGAACTCAGC Chr2:109840739..109840758 60.23 50
upstream ENSMUSE00000315536 Chr2:109841087..109841155 No primer for this exon
upstream ENSMUSE00000345648 Chr2:109842623..109842694 CCTGATGATCTGTGCCAAAA Chr2:109842654..109842673 59.65 45
upstream ENSMUSE00000440130 Chr2:109843611..109843676 TAATGGTTGTCGTGCATTGG Chr2:109843650..109843669 60.38 45
upstream ENSMUSE00000440122 Chr2:109844708..109844779 TGCAGCGTAATCAAATCTCC Chr2:109844713..109844732 58.87 45
upstream ENSMUSE00000440118 Chr2:109846661..109846732 GCGAAGCTTGGGACAATTAC Chr2:109846707..109846726 59.71 50
upstream ENSMUSE00000440113 Chr2:109847302..109847427 CAGCCAGAGACTTTGCCAAT Chr2:109847403..109847422 60.4 50
upstream ENSMUSE00000359323 Chr2:109848242..109848357 AGATAACAGCCCCCAAGACC Chr2:109848317..109848336 60.33 55
upstream ENSMUSE00000315414 Chr2:109848739..109848822 No primer for this exon

*** Putative Vector Insertion (Chr 2: 109848823 - 109851407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000476247 Chr2:109851408..109854412 AGCTGTCCGAGACAAAGGAA Chr2:109852589..109852608 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:109848874..109848894 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000050199