Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19122
Trapped Gene
Nck1 (ENSMUSG00000032475)
Vector Insertion
Chr 9: 100408847 - 100409074
Public Clones not available
Private Clones OST404081 (lexicon) OST232415 (lexicon) OST148679 (lexicon) OST60563 (lexicon)
OST42447 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219929 (Chr9:100408848..100409091 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219929 (Chr9:100408848..100409091 -)
Downstram Exon
ENSMUSE00000706789 (Chr9:100408848..100409073 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45 ATGCTTTCCGAGCACTGTTT Chr9:100408856..100408875 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219928 Chr9:100446414..100446472 No primer for this exon
upstream ENSMUSE00000219929 Chr9:100408848..100409091 AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45
upstream ENSMUSE00000706789 Chr9:100408848..100409073 AAACAGTGCTCGGAAAGCAT Chr9:100408878..100408897 59.88 45

*** Putative Vector Insertion (Chr 9: 100408847 - 100409074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693492 Chr9:100407145..100407275 TGACACAGCTCCGGGATAAT Chr9:100407195..100407214 60.48 50
downstream ENSMUSE00000219930 Chr9:100397677..100398389 GTCATTTTCCGGCTTTTCAA Chr9:100397916..100397935 60.05 40
downstream ENSMUSE00000394476 Chr9:100395424..100396090 AGTACAATTGGCCCAGCACT Chr9:100395792..100395811 59.62 50
downstream ENSMUSE00000633171 Chr9:100392712..100396090 GGTGTCCGTACTCTGGCAAT Chr9:100393103..100393122 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGAAAGATGGCTGAAGA Chr9:100409061..100409081 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGAAAGATGGCTGAAGA Chr9:100409061..100409081 59.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032475