Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19123
Trapped Gene
Fbxo36 (ENSMUSG00000073633)
Vector Insertion
Chr 1: 84893238 - 84896571
Public Clones not available
Private Clones OST404066 (lexicon) OST371358 (lexicon) OST336240 (lexicon) OST309572 (lexicon)
OST302464 (lexicon) OST302257 (lexicon) OST285145 (lexicon) OST282968 (lexicon)
OST277066 (lexicon) OST266338 (lexicon) OST250041 (lexicon) OST242501 (lexicon)
OST213655 (lexicon) OST208530 (lexicon) OST207723 (lexicon) OST200220 (lexicon)
OST200068 (lexicon) OST194555 (lexicon) OST193274 (lexicon) OST191938 (lexicon)
OST185822 (lexicon) OST184858 (lexicon) OST183002 (lexicon) OST139122 (lexicon)
OST126377 (lexicon) OST108075 (lexicon) OST88167 (lexicon) OST71396 (lexicon)
OST50129 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629369 (Chr1:84893065..84893237 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCAACCTGTGCGAAGGTAA Chr1:84893109..84893128 59.32 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629369 (Chr1:84893065..84893237 +)
Downstram Exon
ENSMUSE00000629368 (Chr1:84896572..84897059 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCAACCTGTGCGAAGGTAA Chr1:84893109..84893128 59.32 45 TAGTACTTGGGCCCTGGTTG Chr1:84896952..84896971 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000629372 Chr1:84836420..84836543 GTTGTTGATCACCCGGACTC Chr1:84836522..84836541 60.37 55
upstream ENSMUSE00000629370 Chr1:84877667..84877775 TGAGTATCGGTCAGCAAAACC Chr1:84877702..84877722 60.12 47.62
upstream ENSMUSE00000629369 Chr1:84893065..84893237 TTCAACCTGTGCGAAGGTAA Chr1:84893109..84893128 59.32 45

*** Putative Vector Insertion (Chr 1: 84893238 - 84896571) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000629368 Chr1:84896572..84897059 TAGTACTTGGGCCCTGGTTG Chr1:84896952..84896971 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCACTGATTAATCGCCTTG Chr1:84893280..84893300 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAACAGTCCCTGCTGCTG Chr1:84893238..84893258 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073633