Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19128
Trapped Gene
Rab5a (ENSMUSG00000017831)
Vector Insertion
Chr 17: 53618934 - 53623145
Public Clones IST11632D3 (tigm) IST14319A9 (tigm)
Private Clones OST403968 (lexicon) OST321195 (lexicon) OST176719 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000321375 (Chr17:53618559..53618933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000321375 (Chr17:53618559..53618933 +)
Downstram Exon
ENSMUSE00000364151 (Chr17:53623146..53623400 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000321375 Chr17:53618559..53618933 No primer for this exon

*** Putative Vector Insertion (Chr 17: 53618934 - 53623145) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000364151 Chr17:53623146..53623400 No primer for this exon
downstream ENSMUSE00000542060 Chr17:53636852..53637003 No primer for this exon
downstream ENSMUSE00000136476 Chr17:53637713..53637835 No primer for this exon
downstream ENSMUSE00000542056 Chr17:53639701..53639794 No primer for this exon
downstream ENSMUSE00000542054 Chr17:53645639..53646996 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr17:53621984..53622005 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTATTTGGTGCTTGCGTGA Chr17:53621970..53621990 59.19 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017831