Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19132
Trapped Gene
Plcb4 (ENSMUSG00000039943)
Vector Insertion
Chr 2: 135703118 - 135703218
Public Clones not available
Private Clones OST403783 (lexicon) OST368333 (lexicon) OST331505 (lexicon) OST326628 (lexicon)
OST323491 (lexicon) OST310174 (lexicon) OST289296 (lexicon) OST275295 (lexicon)
OST61451 (lexicon) OST44577 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711482 (Chr2:135703119..135703217 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGCCAAACCTTACGAAT Chr2:135703133..135703152 59.82 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711482 (Chr2:135703119..135703217 +)
Downstram Exon
ENSMUSE00000712135 (Chr2:135703119..135703217 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGCCAAACCTTACGAAT Chr2:135703133..135703152 59.82 45 TCGTAAGGTTTGGCCATGAT Chr2:135703153..135703172 60.33 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682812 Chr2:135567566..135567623 TACCTGGGAGGATTCTCGAC Chr2:135567592..135567611 59.09 55
upstream ENSMUSE00000497642 Chr2:135631284..135631341 GCAGGATTTGATCGGGTAGA Chr2:135631292..135631311 60.04 50
upstream ENSMUSE00000682811 Chr2:135631285..135631341 GCAGGATTTGATCGGGTAGA Chr2:135631292..135631311 60.04 50

*** Putative Vector Insertion (Chr 2: 135703118 - 135703218) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711482 Chr2:135703119..135703217 TCGTAAGGTTTGGCCATGAT Chr2:135703153..135703172 60.33 45
downstream ENSMUSE00000712135 Chr2:135703119..135703217 TCGTAAGGTTTGGCCATGAT Chr2:135703153..135703172 60.33 45
downstream ENSMUSE00000716356 Chr2:135703119..135703217 TCGTAAGGTTTGGCCATGAT Chr2:135703153..135703172 60.33 45
downstream ENSMUSE00000167688 Chr2:135733235..135733315 CTTCCACGTCAGGAAGAAGC Chr2:135733306..135733325 59.99 55
downstream ENSMUSE00000682805 Chr2:135733235..135733315 CTTCCACGTCAGGAAGAAGC Chr2:135733306..135733325 59.99 55
downstream ENSMUSE00000167690 Chr2:135734086..135734145 GCTGCTTGGCGAATACTGTT Chr2:135734138..135734157 60.42 50
downstream ENSMUSE00000682804 Chr2:135734086..135734145 GCTGCTTGGCGAATACTGTT Chr2:135734138..135734157 60.42 50
downstream ENSMUSE00000167685 Chr2:135735837..135735980 GCCCTTCCAGATCATTTTCA Chr2:135735900..135735919 60.01 45
downstream ENSMUSE00000682803 Chr2:135735837..135735980 GCCCTTCCAGATCATTTTCA Chr2:135735900..135735919 60.01 45
downstream ENSMUSE00000396929 Chr2:135755691..135755770 CATCGGACTGACGTTGTTTG Chr2:135755756..135755775 60.15 50
downstream ENSMUSE00000682802 Chr2:135755691..135755770 CATCGGACTGACGTTGTTTG Chr2:135755756..135755775 60.15 50
downstream ENSMUSE00000350832 Chr2:135757985..135758038 TTGGTCAGAAAGGCCAGTTT Chr2:135758014..135758033 59.71 45
downstream ENSMUSE00000682801 Chr2:135757985..135758038 TTGGTCAGAAAGGCCAGTTT Chr2:135758014..135758033 59.71 45
downstream ENSMUSE00000378637 Chr2:135763996..135764077 TGAGGGCTTGAAAGATCACC Chr2:135764054..135764073 60.19 50
downstream ENSMUSE00000682800 Chr2:135763996..135764077 TGAGGGCTTGAAAGATCACC Chr2:135764054..135764073 60.19 50
downstream ENSMUSE00000291202 Chr2:135764946..135765046 ATGCAGCAGGTTCAATTTCA Chr2:135764973..135764992 59.28 40
downstream ENSMUSE00000682799 Chr2:135764946..135765046 ATGCAGCAGGTTCAATTTCA Chr2:135764973..135764992 59.28 40
downstream ENSMUSE00000291194 Chr2:135765683..135765740 No primer for this exon
downstream ENSMUSE00000682798 Chr2:135765683..135765740 No primer for this exon
downstream ENSMUSE00000291187 Chr2:135772782..135772890 TTTCATTCAGCCGAGGATCT Chr2:135772812..135772831 59.77 45
downstream ENSMUSE00000682797 Chr2:135772782..135772890 TTTCATTCAGCCGAGGATCT Chr2:135772812..135772831 59.77 45
downstream ENSMUSE00000291181 Chr2:135775948..135776158 AGGTGTTGTGGGAGGAACTG Chr2:135776088..135776107 60 55
downstream ENSMUSE00000682795 Chr2:135775948..135776158 AGGTGTTGTGGGAGGAACTG Chr2:135776088..135776107 60 55
downstream ENSMUSE00000291175 Chr2:135777729..135777822 TCGGTTCCTGATCTTCACCT Chr2:135777781..135777800 59.65 50
downstream ENSMUSE00000682794 Chr2:135777729..135777822 TCGGTTCCTGATCTTCACCT Chr2:135777781..135777800 59.65 50
downstream ENSMUSE00000291169 Chr2:135780082..135780161 GCAGTGGTTTTCGAAGGAGA Chr2:135780162..135780181 60.38 50
downstream ENSMUSE00000682793 Chr2:135780082..135780161 GCAGTGGTTTTCGAAGGAGA Chr2:135780162..135780181 60.38 50
downstream ENSMUSE00000291160 Chr2:135780651..135780735 TTCAACAGGAGATCCCCAAA Chr2:135780716..135780735 60.43 45
downstream ENSMUSE00000682791 Chr2:135780651..135780735 TTCAACAGGAGATCCCCAAA Chr2:135780716..135780735 60.43 45
downstream ENSMUSE00000291156 Chr2:135783791..135783881 GGTCATTAGGAGACGGCAAG Chr2:135783830..135783849 59.69 55
downstream ENSMUSE00000682790 Chr2:135783791..135783881 GGTCATTAGGAGACGGCAAG Chr2:135783830..135783849 59.69 55
downstream ENSMUSE00000557975 Chr2:135784378..135784473 CCAGCTTCCATCATGCTTTT Chr2:135784417..135784436 60.21 45
downstream ENSMUSE00000682789 Chr2:135784378..135784473 CCAGCTTCCATCATGCTTTT Chr2:135784417..135784436 60.21 45
downstream ENSMUSE00000557972 Chr2:135787455..135787555 AACCGCTTCCTTGTGACTGT Chr2:135787540..135787559 59.77 50
downstream ENSMUSE00000682788 Chr2:135787455..135787555 AACCGCTTCCTTGTGACTGT Chr2:135787540..135787559 59.77 50
downstream ENSMUSE00000682809 Chr2:135790788..135790823 No primer for this exon
downstream ENSMUSE00000291129 Chr2:135792761..135792902 GGATGGATGTTCGTGGTAGC Chr2:135792840..135792859 60.35 55
downstream ENSMUSE00000682787 Chr2:135792761..135792902 GGATGGATGTTCGTGGTAGC Chr2:135792840..135792859 60.35 55
downstream ENSMUSE00000291125 Chr2:135793653..135793737 GCCAACCGACTCGTTAAAAG Chr2:135793702..135793721 59.75 50
downstream ENSMUSE00000682786 Chr2:135793653..135793737 GCCAACCGACTCGTTAAAAG Chr2:135793702..135793721 59.75 50
downstream ENSMUSE00000291120 Chr2:135794057..135794181 CAACCAGCGTTCCAGAAAAT Chr2:135794152..135794171 60.11 45
downstream ENSMUSE00000682785 Chr2:135794057..135794181 CAACCAGCGTTCCAGAAAAT Chr2:135794152..135794171 60.11 45
downstream ENSMUSE00000291114 Chr2:135796130..135796181 CCGCATGATCCATTATACTCAA Chr2:135796182..135796203 59.82 40.91
downstream ENSMUSE00000682784 Chr2:135796130..135796181 CCGCATGATCCATTATACTCAA Chr2:135796182..135796203 59.82 40.91
downstream ENSMUSE00000291107 Chr2:135797494..135797596 GTCCACAGGGGTTTCAGAGA Chr2:135797569..135797588 60.09 55
downstream ENSMUSE00000682782 Chr2:135797494..135797596 GTCCACAGGGGTTTCAGAGA Chr2:135797569..135797588 60.09 55
downstream ENSMUSE00000291096 Chr2:135798648..135798812 GCAGCCCGTACATATCGACT Chr2:135798720..135798739 60.12 55
downstream ENSMUSE00000682781 Chr2:135798648..135798812 GCAGCCCGTACATATCGACT Chr2:135798720..135798739 60.12 55
downstream ENSMUSE00000291091 Chr2:135801835..135802039 AGCTAGGTCAGGCAGGATCA Chr2:135801858..135801877 59.97 55
downstream ENSMUSE00000682779 Chr2:135801835..135802039 AGCTAGGTCAGGCAGGATCA Chr2:135801858..135801877 59.97 55
downstream ENSMUSE00000291083 Chr2:135807769..135807857 TTGGATCGGATAAAGCATCC Chr2:135807798..135807817 59.86 45
downstream ENSMUSE00000682778 Chr2:135807769..135807857 TTGGATCGGATAAAGCATCC Chr2:135807798..135807817 59.86 45
downstream ENSMUSE00000380377 Chr2:135808712..135808862 GTCACTGGGCACATCTGCTA Chr2:135808741..135808760 59.86 55
downstream ENSMUSE00000682777 Chr2:135808712..135808862 GTCACTGGGCACATCTGCTA Chr2:135808741..135808760 59.86 55
downstream ENSMUSE00000682808 Chr2:135808712..135808748 GTCACTGGGCACATCTGCTA Chr2:135808741..135808760 59.86 55
downstream ENSMUSE00000682807 Chr2:135808976..135809001 No primer for this exon
downstream ENSMUSE00000404645 Chr2:135813216..135813265 No primer for this exon
downstream ENSMUSE00000682776 Chr2:135813216..135813265 No primer for this exon
downstream ENSMUSE00000359180 Chr2:135813573..135813638 No primer for this exon
downstream ENSMUSE00000395037 Chr2:135820030..135820145 GTCATACTGGGCCACGATTT Chr2:135820095..135820114 59.82 50
downstream ENSMUSE00000291042 Chr2:135824413..135824488 ATCCGTTGTCAGGGTCTGAA Chr2:135824479..135824498 60.51 50
downstream ENSMUSE00000291035 Chr2:135825870..135826045 TGAGCATTGATGAGCAGCTT Chr2:135826009..135826028 59.7 45
downstream ENSMUSE00000291027 Chr2:135828295..135828396 GATGGCCTTGCTATTTTCCA Chr2:135828358..135828377 60.04 45
downstream ENSMUSE00000291019 Chr2:135833076..135833133 TGCTGTTCAACTCCCTGACTC Chr2:135833100..135833120 60.44 52.38
downstream ENSMUSE00000291013 Chr2:135833559..135833645 No primer for this exon
downstream ENSMUSE00000682775 Chr2:135836672..135836708 GGACACTGCATGACAGGATTT Chr2:135836700..135836720 59.99 47.62
downstream ENSMUSE00000460557 Chr2:135838702..135838804 ATCTCGGCTTCCAATTTCAC Chr2:135838745..135838764 59.13 45
downstream ENSMUSE00000682774 Chr2:135838702..135838804 ATCTCGGCTTCCAATTTCAC Chr2:135838745..135838764 59.13 45
downstream ENSMUSE00000682810 Chr2:135838702..135840329 GGGCATGATCTTCTGGTGTT Chr2:135838829..135838848 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCATCATGGCCAAACCTT Chr2:135703128..135703148 60.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCATCATGGCCAAACCTT Chr2:135703128..135703148 60.19 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039943