Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19134
Trapped Gene
Ccnjl (ENSMUSG00000044707)
Vector Insertion
Chr 11: 43342962 - 43370056
Public Clones not available
Private Clones OST403756 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000580195 (Chr11:43342857..43342961 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGGTAGCTTCATAACTGC Chr11:43342872..43342891 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000580195 (Chr11:43342857..43342961 +)
Downstram Exon
ENSMUSE00000337805 (Chr11:43370057..43370270 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGGTAGCTTCATAACTGC Chr11:43342872..43342891 59.73 55 AAAGAATCGACGGCTCTTCA Chr11:43370119..43370138 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679723 Chr11:43342286..43342469 No primer for this exon
upstream ENSMUSE00000580195 Chr11:43342857..43342961 CCCGGTAGCTTCATAACTGC Chr11:43342872..43342891 59.73 55

*** Putative Vector Insertion (Chr 11: 43342962 - 43370056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337805 Chr11:43370057..43370270 AAAGAATCGACGGCTCTTCA Chr11:43370119..43370138 59.96 45
downstream ENSMUSE00000334246 Chr11:43393186..43393488 CTCCTTGAGGCACTCTTTGG Chr11:43393457..43393476 59.98 55
downstream ENSMUSE00000382788 Chr11:43396682..43396841 CTCGAGACCCTCTGCAAGTC Chr11:43396799..43396818 60.13 60
downstream ENSMUSE00000654226 Chr11:43398794..43400499 GTGGTATCCCTCGCTGTTGT Chr11:43399970..43399989 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCGTATGGTGTTTCCTCA Chr11:43369960..43369980 59.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACTTTTGGGGGAAACGTG Chr11:43369997..43370017 59.83 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044707