Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19146
Trapped Gene
Lace1 (ENSMUSG00000038302)
Vector Insertion
Chr 10: 42174337 - 42198068
Public Clones D155B07 (ggtc) D155B07 (ggtc) IST10069H3 (tigm)
Private Clones OST403552 (lexicon) OST300941 (lexicon) OST287493 (lexicon) OST232580 (lexicon)
OST118821 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370816 (Chr10:42198069..42198221 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACTGGGAGAGGTGTTGG Chr10:42198134..42198153 60.7 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370816 (Chr10:42198069..42198221 -)
Downstram Exon
ENSMUSE00000407277 (Chr10:42174113..42174336 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACTGGGAGAGGTGTTGG Chr10:42198134..42198153 60.7 60 GTACACCCTCGGATGTCTGG Chr10:42174285..42174304 60.39 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000370816 Chr10:42198069..42198221 CTGACTGGGAGAGGTGTTGG Chr10:42198134..42198153 60.7 60

*** Putative Vector Insertion (Chr 10: 42174337 - 42198068) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407277 Chr10:42174113..42174336 GTACACCCTCGGATGTCTGG Chr10:42174285..42174304 60.39 60
downstream ENSMUSE00000296383 Chr10:42158160..42158211 CCCTTTGGAGGTTTGTTCCT Chr10:42158161..42158180 60.33 50
downstream ENSMUSE00000409796 Chr10:42146292..42146393 ATGGACCCGCTTCTTTCTCT Chr10:42146301..42146320 60.21 50
downstream ENSMUSE00000296366 Chr10:42144984..42145114 CTATGGGAGCTATCGGGTCA Chr10:42145012..42145031 60.05 55
downstream ENSMUSE00000296357 Chr10:42135355..42135454 GACCCCGTTTTTGAACAGAT Chr10:42135367..42135386 58.89 45
downstream ENSMUSE00000296347 Chr10:42120147..42120205 TGGCACAAAGTTAGCCCTCT Chr10:42120143..42120162 59.88 50
downstream ENSMUSE00000296337 Chr10:42079971..42080053 CAGCTGGAGCGTATCACAAT Chr10:42080008..42080027 58.9 50
downstream ENSMUSE00000296327 Chr10:42059988..42060058 CCTCCACATCAGCCTCACTT Chr10:42060014..42060033 60.26 55
downstream ENSMUSE00000296320 Chr10:42059631..42059731 CTTTATTCAGCCGCAGCTCT Chr10:42059656..42059675 59.75 50
downstream ENSMUSE00000296311 Chr10:42038398..42038538 AAAACTGCGGAATGTTTCGT Chr10:42038441..42038460 59.62 40
downstream ENSMUSE00000296302 Chr10:42036156..42036269 TCCGACTCACTGTCCTGATG Chr10:42036174..42036193 59.82 55
downstream ENSMUSE00000413000 Chr10:42032394..42033422 TCCTGCATACTCTGCCTGTG Chr10:42032976..42032995 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGCATCCTGAGGCACATTT Chr10:42183096..42183117 60.48 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGCATCCTGAGGCACATTT Chr10:42183096..42183117 60.48 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTCAGGAGCTGAGGGAGGAT Chr10:42183201..42183221 60.89 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGCGTCTTCTGGGTTACAATA Chr10:42183234..42183255 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038302