Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19165
Trapped Gene
Setd6 (ENSMUSG00000031671)
Vector Insertion
Chr 8: 98242002 - 98242092
Public Clones not available
Private Clones OST403261 (lexicon) OST389937 (lexicon) OST161147 (lexicon) OST161051 (lexicon)
OST137422 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211648 (Chr8:98241821..98242001 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATGGTGACAGTCCGAGA Chr8:98241968..98241987 59.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211648 (Chr8:98241821..98242001 +)
Downstram Exon
ENSMUSE00000211649 (Chr8:98242093..98242235 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATGGTGACAGTCCGAGA Chr8:98241968..98241987 59.82 55 TGTGGTGGCTAGCTCCTCTT Chr8:98242232..98242251 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000241414 Chr8:98239813..98240170 GTCCTAAGGTGACGGTGAGC Chr8:98240018..98240037 59.73 60
upstream ENSMUSE00000211645 Chr8:98240253..98240394 ATCACCCTGGAGCCCTTACT Chr8:98240329..98240348 59.96 55
upstream ENSMUSE00000241403 Chr8:98240507..98240701 GCCCTCGTGATGGCTTATAG Chr8:98240682..98240701 59.69 55
upstream ENSMUSE00000241394 Chr8:98240821..98240941 ATGAAAAGGAGCCCAACTCA Chr8:98240850..98240869 59.67 45
upstream ENSMUSE00000211648 Chr8:98241821..98242001 CAGATGGTGACAGTCCGAGA Chr8:98241968..98241987 59.82 55

*** Putative Vector Insertion (Chr 8: 98242002 - 98242092) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211649 Chr8:98242093..98242235 TGTGGTGGCTAGCTCCTCTT Chr8:98242232..98242251 60.01 55
downstream ENSMUSE00000211647 Chr8:98242376..98242904 TGCCAAACTGTCGTCTTCTG Chr8:98242465..98242484 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGACATTCAGATGGTGA Chr8:98241959..98241979 59.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGACATTCAGATGGTGA Chr8:98241959..98241979 59.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031671