Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1917
Trapped Gene
Zfp335 (ENSMUSG00000039834)
Vector Insertion
Chr 2: 164734944 - 164736121
Public Clones AY0030 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492457 (Chr2:164736122..164736372 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAACGGAGGCTGACGACTCT Chr2:164736161..164736180 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492457 (Chr2:164736122..164736372 -)
Downstram Exon
ENSMUSE00000639228 (Chr2:164734706..164734943 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAACGGAGGCTGACGACTCT Chr2:164736161..164736180 60.01 55 GGTCTGGGAGAACACTGGAA Chr2:164734783..164734802 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000493035 Chr2:164737017..164737250 AACCCCGCAGATCTCTCTCT Chr2:164737146..164737165 60.36 55
upstream ENSMUSE00000492457 Chr2:164736122..164736372 TAACGGAGGCTGACGACTCT Chr2:164736161..164736180 60.01 55

*** Putative Vector Insertion (Chr 2: 164734944 - 164736121) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639228 Chr2:164734706..164734943 GGTCTGGGAGAACACTGGAA Chr2:164734783..164734802 60.09 55
downstream ENSMUSE00000639227 Chr2:164733655..164733732 ACCACTGGTCACAGTGATGC Chr2:164733688..164733707 59.58 55
downstream ENSMUSE00000639226 Chr2:164733153..164733458 TGGCCAAGGTGGAAGTAGAC Chr2:164733395..164733414 60.11 55
downstream ENSMUSE00000550909 Chr2:164732928..164733074 GTCCTCCTCTGTGGTCTTGG Chr2:164732970..164732989 59.68 60
downstream ENSMUSE00000639225 Chr2:164730341..164730487 No primer for this exon
downstream ENSMUSE00000639224 Chr2:164727996..164728236 CCGACTGACTAACGCCTGAT Chr2:164728074..164728093 60.28 55
downstream ENSMUSE00000639223 Chr2:164727708..164727885 CCACATATGCGGCACAGATA Chr2:164727807..164727826 60.51 50
downstream ENSMUSE00000241437 Chr2:164726918..164727030 ATCCTTGCGGTAGACACTGG Chr2:164726931..164726950 60.13 55
downstream ENSMUSE00000639222 Chr2:164726001..164726019 No primer for this exon
downstream ENSMUSE00000639221 Chr2:164725778..164725894 CTCGGTGCTGTGAGTCTTCA Chr2:164725777..164725796 60.18 55
downstream ENSMUSE00000593206 Chr2:164725611..164725687 TGAGCAGGTGCATTTTGAAG Chr2:164725617..164725636 59.99 45
downstream ENSMUSE00000241404 Chr2:164725371..164725531 GGACAGTTGGTGGTTCAACA Chr2:164725443..164725462 59.42 50
downstream ENSMUSE00000639220 Chr2:164725371..164725531 GGACAGTTGGTGGTTCAACA Chr2:164725443..164725462 59.42 50
downstream ENSMUSE00000408452 Chr2:164724757..164724986 CTGTGTTGCTGCTTCAGCTC Chr2:164724775..164724794 59.93 55
downstream ENSMUSE00000679882 Chr2:164724757..164724986 CTGTGTTGCTGCTTCAGCTC Chr2:164724775..164724794 59.93 55
downstream ENSMUSE00000241388 Chr2:164723684..164723777 AGGTGACTGGAAAGGTGCTG Chr2:164723723..164723742 60.3 55
downstream ENSMUSE00000679881 Chr2:164723684..164723777 AGGTGACTGGAAAGGTGCTG Chr2:164723723..164723742 60.3 55
downstream ENSMUSE00000241384 Chr2:164723489..164723583 GCGCTCATATTCAACAGCAG Chr2:164723498..164723517 59.6 50
downstream ENSMUSE00000679880 Chr2:164723489..164723583 GCGCTCATATTCAACAGCAG Chr2:164723498..164723517 59.6 50
downstream ENSMUSE00000241379 Chr2:164721488..164721747 GAAGGTTGCCCACCAGTAGA Chr2:164721664..164721683 60.11 55
downstream ENSMUSE00000679879 Chr2:164721488..164721747 GAAGGTTGCCCACCAGTAGA Chr2:164721664..164721683 60.11 55
downstream ENSMUSE00000241373 Chr2:164720478..164720589 TGAGAGTGTCGCTCACAACC Chr2:164720515..164720534 60.03 55
downstream ENSMUSE00000679877 Chr2:164720478..164720589 TGAGAGTGTCGCTCACAACC Chr2:164720515..164720534 60.03 55
downstream ENSMUSE00000372146 Chr2:164720025..164720399 ATGGTGGGTCTTTGTTGGAG Chr2:164720246..164720265 59.82 50
downstream ENSMUSE00000679876 Chr2:164720025..164720399 ATGGTGGGTCTTTGTTGGAG Chr2:164720246..164720265 59.82 50
downstream ENSMUSE00000241352 Chr2:164719201..164719343 CTTCTCGTTGGTGTGCGTTA Chr2:164719208..164719227 59.9 50
downstream ENSMUSE00000679875 Chr2:164719201..164719343 CTTCTCGTTGGTGTGCGTTA Chr2:164719208..164719227 59.9 50
downstream ENSMUSE00000241346 Chr2:164718973..164719115 GCTATGTAGCCGCTGGATGT Chr2:164719045..164719064 60.26 55
downstream ENSMUSE00000679874 Chr2:164718973..164719115 GCTATGTAGCCGCTGGATGT Chr2:164719045..164719064 60.26 55
downstream ENSMUSE00000241339 Chr2:164718746..164718849 GGGCCACAATGATGTGTTCT Chr2:164718747..164718766 60.79 50
downstream ENSMUSE00000679873 Chr2:164718746..164718849 GGGCCACAATGATGTGTTCT Chr2:164718747..164718766 60.79 50
downstream ENSMUSE00000362577 Chr2:164718378..164718452 TGTACTGTCTGGCCATCTGC Chr2:164718381..164718400 59.86 55
downstream ENSMUSE00000679872 Chr2:164718378..164718452 TGTACTGTCTGGCCATCTGC Chr2:164718381..164718400 59.86 55
downstream ENSMUSE00000402656 Chr2:164718187..164718270 CAGGGACCACAACGTACTCC Chr2:164718182..164718201 60.42 60
downstream ENSMUSE00000679871 Chr2:164718187..164718270 CAGGGACCACAACGTACTCC Chr2:164718182..164718201 60.42 60
downstream ENSMUSE00000241323 Chr2:164718041..164718106 GCAGGAATGGAGTACCTTGC Chr2:164718030..164718049 59.7 55
downstream ENSMUSE00000679870 Chr2:164718041..164718106 GCAGGAATGGAGTACCTTGC Chr2:164718030..164718049 59.7 55
downstream ENSMUSE00000241315 Chr2:164717880..164717961 No primer for this exon
downstream ENSMUSE00000679868 Chr2:164717880..164717961 No primer for this exon
downstream ENSMUSE00000347740 Chr2:164717393..164717791 GAGGCTCAGTCATCCGAGAG Chr2:164717637..164717656 60.1 60
downstream ENSMUSE00000679867 Chr2:164717393..164717791 GAGGCTCAGTCATCCGAGAG Chr2:164717637..164717656 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATCAGTGTGGATGGTGT Chr2:164736097..164736117 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATCAGTGTGGATGGTGT Chr2:164736097..164736117 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039834