Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19184
Trapped Gene
8430427H17Rik (ENSMUSG00000061411)
Vector Insertion
Chr 2: 153246546 - 153261941
Public Clones (ggtc) (ggtc)
Private Clones OST403072 (lexicon) OST155094 (lexicon) OST64149 (lexicon) OST33532 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000276502 (Chr2:153261942..153262083 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATGAATGACTCCGCATGGA Chr2:153262032..153262051 60.03 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000276502 (Chr2:153261942..153262083 -)
Downstram Exon
ENSMUSE00000460716 (Chr2:153246268..153246545 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATGAATGACTCCGCATGGA Chr2:153262032..153262051 60.03 45 GTGGATGGGTTCAGGGTAGA Chr2:153246466..153246485 59.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000555729 Chr2:153355178..153355709 CGACTCGGCTAAAACCAAGA Chr2:153355372..153355391 60.38 50
upstream ENSMUSE00000504458 Chr2:153309423..153309578 CTACTCGATGCACGTGGAGA Chr2:153309482..153309501 60.01 55
upstream ENSMUSE00000276516 Chr2:153303607..153303718 GAGAGGCTGTGACTCGGTTC Chr2:153303671..153303690 59.99 60
upstream ENSMUSE00000276509 Chr2:153296424..153296533 TGATTACAACATGCCCCTCA Chr2:153296477..153296496 59.92 45
upstream ENSMUSE00000681596 Chr2:153270093..153270215 CCGGTTCACTCCCAGAGCTA Chr2:153270125..153270144 62.65 60
upstream ENSMUSE00000276502 Chr2:153261942..153262083 TATGAATGACTCCGCATGGA Chr2:153262032..153262051 60.03 45

*** Putative Vector Insertion (Chr 2: 153246546 - 153261941) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460716 Chr2:153246268..153246545 GTGGATGGGTTCAGGGTAGA Chr2:153246466..153246485 59.78 55
downstream ENSMUSE00000461586 Chr2:153243696..153243881 ATCGTCATCGTCATCTGCTG Chr2:153243752..153243771 59.82 50
downstream ENSMUSE00000471602 Chr2:153243424..153243615 GGTTCTCATCCACGAAGAGC Chr2:153243563..153243582 59.81 55
downstream ENSMUSE00000463499 Chr2:153243099..153243221 AGGTCAGATGCGGAGGAGTA Chr2:153243172..153243191 59.83 55
downstream ENSMUSE00000384147 Chr2:153242380..153242581 AGTCCCGAGAGTGCTGCTTA Chr2:153242520..153242539 60.16 55
downstream ENSMUSE00000466561 Chr2:153233202..153237565 CAGACAGAATGCGGTAAGCA Chr2:153235321..153235340 60.01 50
downstream ENSMUSE00000681598 Chr2:153233198..153237565 CAGACAGAATGCGGTAAGCA Chr2:153235321..153235340 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:153261871..153261891 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGTGCCTCCCAGATCATT Chr2:153261951..153261971 59.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATACAGCCCCCAGACTCAG Chr2:153262091..153262111 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATACAGCCCCCAGACTCAG Chr2:153262091..153262111 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061411