Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19195
Trapped Gene
Herc4 (ENSMUSG00000020064)
Vector Insertion
Chr 10: 62706912 - 62708165
Public Clones (sanger) D091D05 (ggtc) E043B03 (ggtc) D125F10 (ggtc) D091D05 (ggtc)
D151C04 (ggtc) 5SE314G07 (ggtc) D125C02 (ggtc) H008C06 (ggtc) D039G08 (ggtc)
D151C04 (ggtc) IST14523B2 (tigm)
Private Clones OST402258 (lexicon) OST330339 (lexicon) OST317343 (lexicon) OST215449 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612373 (Chr10:62706659..62706911 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612373 (Chr10:62706659..62706911 +)
Downstram Exon
ENSMUSE00000612375 (Chr10:62708166..62708196 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612373 Chr10:62706659..62706911 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62706912 - 62708165) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612375 Chr10:62708166..62708196 No primer for this exon
downstream ENSMUSE00000612374 Chr10:62708570..62708873 No primer for this exon
downstream ENSMUSE00000271065 Chr10:62726774..62726933 No primer for this exon
downstream ENSMUSE00000100273 Chr10:62732376..62732452 No primer for this exon
downstream ENSMUSE00000453488 Chr10:62736199..62736420 No primer for this exon
downstream ENSMUSE00000453483 Chr10:62737745..62737836 No primer for this exon
downstream ENSMUSE00000453479 Chr10:62741083..62741213 No primer for this exon
downstream ENSMUSE00000453474 Chr10:62745929..62746089 No primer for this exon
downstream ENSMUSE00000453471 Chr10:62748400..62748476 No primer for this exon
downstream ENSMUSE00000453468 Chr10:62748765..62748889 No primer for this exon
downstream ENSMUSE00000453466 Chr10:62750267..62750326 No primer for this exon
downstream ENSMUSE00000453461 Chr10:62750646..62750757 No primer for this exon
downstream ENSMUSE00000453459 Chr10:62751800..62751989 No primer for this exon
downstream ENSMUSE00000358847 Chr10:62753252..62753424 No primer for this exon
downstream ENSMUSE00000270957 Chr10:62761868..62761987 No primer for this exon
downstream ENSMUSE00000575853 Chr10:62766593..62766616 No primer for this exon
downstream ENSMUSE00000270945 Chr10:62769096..62769194 No primer for this exon
downstream ENSMUSE00000270935 Chr10:62770490..62770657 No primer for this exon
downstream ENSMUSE00000270922 Chr10:62771055..62771198 No primer for this exon
downstream ENSMUSE00000270910 Chr10:62774215..62774381 No primer for this exon
downstream ENSMUSE00000270901 Chr10:62774596..62774662 No primer for this exon
downstream ENSMUSE00000270894 Chr10:62777235..62777317 No primer for this exon
downstream ENSMUSE00000270886 Chr10:62778408..62778591 No primer for this exon
downstream ENSMUSE00000270879 Chr10:62779448..62779550 No primer for this exon
downstream ENSMUSE00000401134 Chr10:62780028..62780622 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCATCGCTTAGGGCTCTC Chr10:62706875..62706895 61.38 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCATCGCTTAGGGCTCTC Chr10:62706875..62706895 61.38 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020064