Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19205
Trapped Gene
Zfp428 (ENSMUSG00000064264)
Vector Insertion
Chr 7: 25292456 - 25295564
Public Clones (sanger) P101C12 (ggtc) IST13443D12 (tigm) IST10098E9 (tigm) IST12472G3 (tigm)
IST12489B8 (tigm) IST14974G4 (tigm) IST12472G3 (tigm)
Private Clones OST401801 (lexicon) OST302985 (lexicon) OST263696 (lexicon) OST221108 (lexicon)
OST215700 (lexicon) OST195376 (lexicon) OST145689 (lexicon) OST33462 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465219 (Chr7:25292149..25292455 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGCGATTCTTAAAGCTTCTT Chr7:25292159..25292179 60.13 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465219 (Chr7:25292149..25292455 +)
Downstram Exon
ENSMUSE00000466971 (Chr7:25295565..25295772 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGCGATTCTTAAAGCTTCTT Chr7:25292159..25292179 60.13 42.86 GGTTCACGGGTCTCTGTCAT Chr7:25295719..25295738 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000465219 Chr7:25292149..25292455 GCGCGATTCTTAAAGCTTCTT Chr7:25292159..25292179 60.13 42.86

*** Putative Vector Insertion (Chr 7: 25292456 - 25295564) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000466971 Chr7:25295565..25295772 GGTTCACGGGTCTCTGTCAT Chr7:25295719..25295738 59.97 55
downstream ENSMUSE00000536074 Chr7:25295752..25295772 CTGGGGAAAGGTCTTCATCA Chr7:25295775..25295794 60.04 50
downstream ENSMUSE00000536073 Chr7:25300056..25300124 AGTCGGGCTCTGAAAGAGTG Chr7:25300106..25300125 59.6 55
downstream ENSMUSE00000471624 Chr7:25300095..25300549 TATTCGGGGTCATCAGTGGT Chr7:25300158..25300177 60.19 50
downstream ENSMUSE00000536072 Chr7:25300127..25300549 TATTCGGGGTCATCAGTGGT Chr7:25300158..25300177 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAATGGGGTAATCGCCTTG Chr7:25292498..25292518 61.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTTAGAATGGGGCGTGAC Chr7:25292493..25292513 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064264