Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19211
Trapped Gene
Kat2b (ENSMUSG00000000708)
Vector Insertion
Chr 17: 53768742 - 53771861
Public Clones not available
Private Clones OST401417 (lexicon) OST185005 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136498 (Chr17:53768649..53768741 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136498 (Chr17:53768649..53768741 +)
Downstram Exon
ENSMUSE00000500961 (Chr17:53771862..53772043 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657192 Chr17:53706640..53706903 No primer for this exon
upstream ENSMUSE00000321124 Chr17:53750189..53750315 No primer for this exon
upstream ENSMUSE00000136510 Chr17:53763677..53763822 No primer for this exon
upstream ENSMUSE00000136498 Chr17:53768649..53768741 No primer for this exon

*** Putative Vector Insertion (Chr 17: 53768742 - 53771861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500961 Chr17:53771862..53772043 No primer for this exon
downstream ENSMUSE00000136503 Chr17:53777677..53777868 No primer for this exon
downstream ENSMUSE00000136509 Chr17:53780518..53780624 No primer for this exon
downstream ENSMUSE00000136495 Chr17:53783939..53784061 No primer for this exon
downstream ENSMUSE00000136490 Chr17:53788072..53788208 No primer for this exon
downstream ENSMUSE00000136507 Chr17:53792347..53792555 No primer for this exon
downstream ENSMUSE00000136497 Chr17:53793764..53793890 No primer for this exon
downstream ENSMUSE00000136502 Chr17:53798643..53798753 No primer for this exon
downstream ENSMUSE00000136493 Chr17:53799354..53799497 No primer for this exon
downstream ENSMUSE00000136489 Chr17:53802860..53802974 No primer for this exon
downstream ENSMUSE00000136500 Chr17:53804731..53804767 No primer for this exon
downstream ENSMUSE00000136505 Chr17:53804978..53805041 No primer for this exon
downstream ENSMUSE00000496895 Chr17:53805148..53805232 No primer for this exon
downstream ENSMUSE00000514532 Chr17:53810000..53812045 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:53771792..53771812 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGAGCGTGACTGGGAAAAC Chr17:53771787..53771808 61.63 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000708