Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19219
Trapped Gene
Grk5 (ENSMUSG00000003228)
Vector Insertion
Chr 19: 61107768 - 61121979
Public Clones not available
Private Clones OST401070 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000616995 (Chr19:61107655..61107767 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000616995 (Chr19:61107655..61107767 +)
Downstram Exon
ENSMUSE00000616994 (Chr19:61121980..61122057 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640270 Chr19:60965652..60966534 No primer for this exon
upstream ENSMUSE00000616996 Chr19:61063605..61063700 No primer for this exon
upstream ENSMUSE00000616995 Chr19:61107655..61107767 No primer for this exon

*** Putative Vector Insertion (Chr 19: 61107768 - 61121979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000616994 Chr19:61121980..61122057 No primer for this exon
downstream ENSMUSE00000431586 Chr19:61144451..61144551 No primer for this exon
downstream ENSMUSE00000508031 Chr19:61145207..61145299 No primer for this exon
downstream ENSMUSE00000510075 Chr19:61148337..61148400 No primer for this exon
downstream ENSMUSE00000500627 Chr19:61149292..61149432 No primer for this exon
downstream ENSMUSE00000505440 Chr19:61152541..61152731 No primer for this exon
downstream ENSMUSE00000499837 Chr19:61155240..61155277 No primer for this exon
downstream ENSMUSE00000546483 Chr19:61156757..61156846 No primer for this exon
downstream ENSMUSE00000496190 Chr19:61158964..61159172 No primer for this exon
downstream ENSMUSE00000498256 Chr19:61161975..61162112 No primer for this exon
downstream ENSMUSE00000492513 Chr19:61165814..61165951 No primer for this exon
downstream ENSMUSE00000494602 Chr19:61166411..61166542 No primer for this exon
downstream ENSMUSE00000546477 Chr19:61167797..61168449 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTGACAGAACCCCCACT Chr19:61119723..61119743 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTTGACAGAACCCCCACT Chr19:61119723..61119743 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003228