Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19233
Trapped Gene
5730409G15Rik (ENSMUSG00000022544)
Vector Insertion
Chr 16: 5253181 - 5255933
Public Clones D185A10 (ggtc) D185A10 (ggtc) IST14287F2 (tigm)
Private Clones OST399700 (lexicon) OST378927 (lexicon) OST323421 (lexicon) OST298212 (lexicon)
OST252373 (lexicon) OST246387 (lexicon) OST203822 (lexicon) OST181150 (lexicon)
OST148150 (lexicon) OST98952 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000480632 (Chr16:5255934..5256049 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000480632 (Chr16:5255934..5256049 -)
Downstram Exon
ENSMUSE00000498402 (Chr16:5253118..5253180 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCAGAATAGCCAGCAACAG Chr16:5253100..5253119 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480632 Chr16:5255934..5256049 No primer for this exon

*** Putative Vector Insertion (Chr 16: 5253181 - 5255933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498402 Chr16:5253118..5253180 TGCAGAATAGCCAGCAACAG Chr16:5253100..5253119 60.16 50
downstream ENSMUSE00000491686 Chr16:5250568..5250648 CACACAGGGTGCTTCACAGT Chr16:5250607..5250626 59.78 55
downstream ENSMUSE00000487712 Chr16:5249440..5249541 GCCTCATACAGTGCATCCAA Chr16:5249476..5249495 59.68 50
downstream ENSMUSE00000128138 Chr16:5249005..5249138 TAGAGAGCAGCGTCCCATGT Chr16:5249028..5249047 60.97 55
downstream ENSMUSE00000128140 Chr16:5248658..5248923 TAAGGAGAAGCCGTTGAGGA Chr16:5248754..5248773 59.95 50
downstream ENSMUSE00000128136 Chr16:5247546..5247692 GGACCCTGACCAGTGACAGT Chr16:5247626..5247645 60.01 60
downstream ENSMUSE00000450304 Chr16:5244248..5245478 TCGCTCACTCACAGATGACC Chr16:5244630..5244649 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTATCAGGGTCGAGCACCA Chr16:5255891..5255911 63.38 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTATCAGGGTCGAGCACCA Chr16:5255891..5255911 63.38 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTAATCGCCTTGCAGCACAT Chr16:5255980..5256001 62.07 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000022544