Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19251
Trapped Gene
Oxr1 (ENSMUSG00000022307)
Vector Insertion
Chr 15: 41367274 - 41485010
Public Clones IST15109G6 (tigm) IST11140E6 (tigm) IST11501G7 (tigm) IST11078F4 (tigm)
IST14197C2 (tigm) IST12001E2 (tigm) IST15109G6 (tigm) IST11694C12 (tigm)
IST14884H2 (tigm) IST11140E6 (tigm)
Private Clones OST398539 (lexicon) OST279275 (lexicon) OST243979 (lexicon) OST81140 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000624065 (Chr15:41367116..41367273 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGTTCTGCCTGTTCCAAG Chr15:41367141..41367160 60.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000624065 (Chr15:41367116..41367273 +)
Downstram Exon
ENSMUSE00000624064 (Chr15:41485011..41485207 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGTTCTGCCTGTTCCAAG Chr15:41367141..41367160 60.69 55 GGTTGAACCCTGGAGCAGTA Chr15:41485063..41485082 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683442 Chr15:41279047..41279135 No primer for this exon
upstream ENSMUSE00000624065 Chr15:41367116..41367273 GTGGTTCTGCCTGTTCCAAG Chr15:41367141..41367160 60.69 55

*** Putative Vector Insertion (Chr 15: 41367274 - 41485010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624064 Chr15:41485011..41485207 GGTTGAACCCTGGAGCAGTA Chr15:41485063..41485082 60.11 55
downstream ENSMUSE00000350104 Chr15:41621069..41621164 AAGCGCTTCCGATTACAAAG Chr15:41621148..41621167 59.5 45
downstream ENSMUSE00000683455 Chr15:41628977..41628991 No primer for this exon
downstream ENSMUSE00000683441 Chr15:41629020..41629102 AGGTCTTCTTTTGGCCAGTG Chr15:41629043..41629062 59.33 50
downstream ENSMUSE00000649491 Chr15:41629022..41629102 No primer for this exon
downstream ENSMUSE00000624062 Chr15:41632017..41632124 TCACGACTGCTCGAGAGAAT Chr15:41632119..41632138 58.7 50
downstream ENSMUSE00000624061 Chr15:41633128..41633241 AGGGATGGGGAACTCTCAAC Chr15:41633186..41633205 60.31 55
downstream ENSMUSE00000624060 Chr15:41645120..41645272 TTTGGATGGGCTACATCTGG Chr15:41645145..41645164 60.85 50
downstream ENSMUSE00000624059 Chr15:41648628..41648812 TGATGCCGTATTCCTCACAA Chr15:41648736..41648755 60.07 45
downstream ENSMUSE00000711367 Chr15:41651385..41652124 GAGCTAGTGCGGTCAGGAAC Chr15:41651711..41651730 60.02 60
downstream ENSMUSE00000722306 Chr15:41651385..41652124 GAGCTAGTGCGGTCAGGAAC Chr15:41651711..41651730 60.02 60
downstream ENSMUSE00000649489 Chr15:41654873..41655041 TAATCGATGCCTTCGCTTTT Chr15:41654913..41654932 59.82 40
downstream ENSMUSE00000649505 Chr15:41654873..41655041 TAATCGATGCCTTCGCTTTT Chr15:41654913..41654932 59.82 40
downstream ENSMUSE00000649488 Chr15:41657436..41657598 CGCTTCAGACTCGTCCATCT Chr15:41657559..41657578 60.56 55
downstream ENSMUSE00000649530 Chr15:41657436..41657598 CGCTTCAGACTCGTCCATCT Chr15:41657559..41657578 60.56 55
downstream ENSMUSE00000125412 Chr15:41680216..41680296 AGAGTGTGCGCAGTTCTTCA Chr15:41680285..41680304 59.78 50
downstream ENSMUSE00000683447 Chr15:41680216..41680296 AGAGTGTGCGCAGTTCTTCA Chr15:41680285..41680304 59.78 50
downstream ENSMUSE00000649485 Chr15:41682005..41682130 TTTGGTCGGAAAGATTCAGG Chr15:41682087..41682106 60.04 45
downstream ENSMUSE00000649528 Chr15:41682005..41682130 TTTGGTCGGAAAGATTCAGG Chr15:41682087..41682106 60.04 45
downstream ENSMUSE00000649483 Chr15:41682921..41683073 CCATGGATAGCCAATGGTTC Chr15:41682965..41682984 60.15 50
downstream ENSMUSE00000649526 Chr15:41682921..41683073 CCATGGATAGCCAATGGTTC Chr15:41682965..41682984 60.15 50
downstream ENSMUSE00000649482 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649525 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649480 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649523 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649479 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649500 Chr15:41690704..41692594 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649522 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAAGTAATCGCCTTGCAG Chr15:41451319..41451339 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGCTGTCCTTGCATTCATA Chr15:41451268..41451289 59.44 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022307