Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19256
Trapped Gene
Seh1l (ENSMUSG00000079614)
Vector Insertion
Chr 18: 67934775 - 67938858
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(ggtc) (ggtc) (ggtc) IST14130G2 (tigm) IST14470G3 (tigm) IST13606E7 (tigm)
IST14425B1 (tigm) IST14517B7 (tigm) IST14365B12 (tigm) IST14583E3 (tigm)
IST15069A12 (tigm) IST14921A6 (tigm) IST14904D11 (tigm) IST14449F9 (tigm)
Private Clones OST398480 (lexicon) OST394119 (lexicon) OST296157 (lexicon) OST285151 (lexicon)
OST267443 (lexicon) OST245621 (lexicon) OST240462 (lexicon) OST205105 (lexicon)
OST204649 (lexicon) OST179297 (lexicon) OST167498 (lexicon) OST130617 (lexicon)
OST129331 (lexicon) OST116415 (lexicon) OST65891 (lexicon) OST43122 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386284 (Chr18:67934530..67934774 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386284 (Chr18:67934530..67934774 +)
Downstram Exon
ENSMUSE00000143171 (Chr18:67938859..67938909 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50 GCTCTCGCTCTTATCCCACA Chr18:67938882..67938901 60.5 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386284 Chr18:67934530..67934774 CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50
upstream ENSMUSE00000707351 Chr18:67934657..67934774 CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50

*** Putative Vector Insertion (Chr 18: 67934775 - 67938858) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000143171 Chr18:67938859..67938909 GCTCTCGCTCTTATCCCACA Chr18:67938882..67938901 60.5 55
downstream ENSMUSE00000143165 Chr18:67943569..67943715 CACACGCCATACAGATCCAC Chr18:67943598..67943617 59.99 55
downstream ENSMUSE00000143164 Chr18:67944541..67944752 GCAGCACAGCTTACACGAGA Chr18:67944729..67944748 60.36 55
downstream ENSMUSE00000143175 Chr18:67946810..67946908 TTGGCCATTGAATTTGGACT Chr18:67946878..67946897 60.31 40
downstream ENSMUSE00000143173 Chr18:67948346..67948486 GGTTGCTACTGCCAGGATGT Chr18:67948454..67948473 60.14 55
downstream ENSMUSE00000143167 Chr18:67948994..67949151 GTTCCAACTCACCCTCCAGA Chr18:67949096..67949115 60.09 55
downstream ENSMUSE00000357593 Chr18:67951518..67951669 TTACTGGGCTCCCGTTACCT Chr18:67951580..67951599 60.87 55
downstream ENSMUSE00000707352 Chr18:67951518..67952247 TGGCTCACATGAATCCGTAA Chr18:67951843..67951862 60.07 45
downstream ENSMUSE00000414890 Chr18:67952804..67953250 AAGGCCTTTTGGACTGTGTG Chr18:67952973..67952992 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAATAGCCACTGTGTGCAG Chr18:67937766..67937787 59.38 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAATAGCCACTGTGTGCAG Chr18:67937766..67937787 59.38 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079614