Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19263
Trapped Gene
Rcor2 (ENSMUSG00000024968)
Vector Insertion
Chr 19: 7341915 - 7343340
Public Clones IST12009E7 (tigm) IST15058F11 (tigm) IST13901D6 (tigm) IST10963F7 (tigm)
IST11551E6 (tigm) IST13870G4 (tigm) IST13879G5 (tigm)
Private Clones OST398205 (lexicon) OST253199 (lexicon) OST231494 (lexicon) OST159203 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454289 (Chr19:7341894..7341914 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454289 (Chr19:7341894..7341914 +)
Downstram Exon
ENSMUSE00000711978 (Chr19:7343341..7343578 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGAGGGCATTACCCTACCC Chr19:7343464..7343483 60.7 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454289 Chr19:7341894..7341914 No primer for this exon

*** Putative Vector Insertion (Chr 19: 7341915 - 7343340) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481800 Chr19:7343022..7343578 GAGGACGGCAGAAAAGTTTG Chr19:7343254..7343273 59.85 50
downstream ENSMUSE00000711978 Chr19:7343341..7343578 CTGAGGGCATTACCCTACCC Chr19:7343464..7343483 60.7 60
downstream ENSMUSE00000713024 Chr19:7343341..7343578 CTGAGGGCATTACCCTACCC Chr19:7343464..7343483 60.7 60
downstream ENSMUSE00000621980 Chr19:7344255..7344311 ATTGGTTCCAACTCGGATCA Chr19:7344283..7344302 60.32 45
downstream ENSMUSE00000621981 Chr19:7344255..7344311 ATTGGTTCCAACTCGGATCA Chr19:7344283..7344302 60.32 45
downstream ENSMUSE00000239513 Chr19:7344591..7344671 AGCATTCCCTTCAGCTCCTT Chr19:7344636..7344655 60.35 50
downstream ENSMUSE00000146719 Chr19:7345044..7345096 ATAGCCATGCTTCTCCTTGG Chr19:7345087..7345106 59.29 50
downstream ENSMUSE00000550726 Chr19:7345188..7345349 AACAGCACCTTGTCCTCCAC Chr19:7345300..7345319 60.16 55
downstream ENSMUSE00000239457 Chr19:7345460..7345584 CCTGCCTGTCCATCACACTA Chr19:7345550..7345569 59.7 55
downstream ENSMUSE00000454506 Chr19:7345683..7345752 GGGTCTCCAGTATCCGGTTC Chr19:7345745..7345764 60.71 60
downstream ENSMUSE00000239443 Chr19:7345829..7346044 ACTCAGGTACATGCCCTTGG Chr19:7345954..7345973 59.99 55
downstream ENSMUSE00000146721 Chr19:7347590..7347667 GGCTGCTATTGGTCTGCTTC Chr19:7347623..7347642 59.99 55
downstream ENSMUSE00000146716 Chr19:7348323..7348380 AGCGGGAGTTGAACTTGGTA Chr19:7348350..7348369 59.73 50
downstream ENSMUSE00000146718 Chr19:7348510..7348739 CTGCAATAGCCCCAAAGTCT Chr19:7348551..7348570 59.34 50
downstream ENSMUSE00000363943 Chr19:7348833..7349714 GGGGTACTGATCGGGGTACT Chr19:7348881..7348900 60.07 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTGGGTCTGGCTTTAAT Chr19:7341950..7341970 61.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGCTTCGTGACTGGGAAA Chr19:7341959..7341979 63.61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024968