Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19271
Trapped Gene
Gabarapl2 (ENSMUSG00000031950)
Vector Insertion
Chr 8: 114465116 - 114466401
Public Clones CMHD-GT_486F12-3 (cmhd) IST15008G1 (tigm) IST10677G10 (tigm) IST11589B7 (tigm)
IST14821D3 (tigm) IST10677G10 (tigm) IST10381A10 (tigm) IST10586B5 (tigm)
Private Clones OST397800 (lexicon) OST376488 (lexicon) OST282284 (lexicon) OST275891 (lexicon)
OST214285 (lexicon) OST67347 (lexicon) OST67091 (lexicon) OST66513 (lexicon)
OST30952 (lexicon) OST21665 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214915 (Chr8:114465060..114465115 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGTACCCCGACCGAGTTC Chr8:114465094..114465113 60.88 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214915 (Chr8:114465060..114465115 +)
Downstram Exon
ENSMUSE00000214916 (Chr8:114466402..114466574 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGTACCCCGACCGAGTTC Chr8:114465094..114465113 60.88 60 AACAATCTGAGAGCCCGAGA Chr8:114466440..114466459 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359315 Chr8:114464622..114464752 GTTGTTGTTGTGGTCGCTTC Chr8:114464652..114464671 59.19 50
upstream ENSMUSE00000214915 Chr8:114465060..114465115 GAAGTACCCCGACCGAGTTC Chr8:114465094..114465113 60.88 60

*** Putative Vector Insertion (Chr 8: 114465116 - 114466401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214916 Chr8:114466402..114466574 AACAATCTGAGAGCCCGAGA Chr8:114466440..114466459 59.95 50
downstream ENSMUSE00000397727 Chr8:114476215..114476814 GTGTTCTCTCCGCTGTAGGC Chr8:114476295..114476314 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr8:114465165..114465185 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031950