Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19272
Trapped Gene
4921516M08Rik (ENSMUSG00000078941)
Vector Insertion
Chr 13: 101421401 - 101424145
Public Clones not available
Private Clones OST397777 (lexicon) OST173409 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720334 (Chr13:101421368..101421400 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCCGAATATCCTGCTCA Chr13:101421378..101421397 60.32 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720334 (Chr13:101421368..101421400 +)
Downstram Exon
ENSMUSE00000360289 (Chr13:101424146..101424238 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCCGAATATCCTGCTCA Chr13:101421378..101421397 60.32 50 TTTTTCCAACCCCTGGTGTA Chr13:101424169..101424188 60.2 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720334 Chr13:101421368..101421400 GCTTCCGAATATCCTGCTCA Chr13:101421378..101421397 60.32 50

*** Putative Vector Insertion (Chr 13: 101421401 - 101424145) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360289 Chr13:101424146..101424238 TTTTTCCAACCCCTGGTGTA Chr13:101424169..101424188 60.2 45
downstream ENSMUSE00000119559 Chr13:101433850..101433908 CCTCATCGTAGCCGTCGTAT Chr13:101433879..101433898 60.12 55
downstream ENSMUSE00000291849 Chr13:101434006..101434151 AGTCACAGCCGTGGTAATCC Chr13:101434075..101434094 60 55
downstream ENSMUSE00000365918 Chr13:101435782..101435974 TCCTCGAGCTGTTCTGGTTC Chr13:101435919..101435938 60.53 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGGGAAGGAGGACTATG Chr13:101421357..101421377 60.98 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGGGGAAGGAGGACTATG Chr13:101421357..101421377 60.98 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078941