Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19280
Trapped Gene
Afg3l1 (ENSMUSG00000031967)
Vector Insertion
Chr 8: 126004337 - 126004970
Public Clones not available
Private Clones OST397049 (lexicon) OST182479 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389561 (Chr8:126004249..126004336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTTCCCCGAGGCTGTATT Chr8:126004302..126004321 59.8 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389561 (Chr8:126004249..126004336 +)
Downstram Exon
ENSMUSE00000287472 (Chr8:126004971..126005045 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTTCCCCGAGGCTGTATT Chr8:126004302..126004321 59.8 45 TGGGCTTGCACTTTTTCTGT Chr8:126005023..126005042 60.81 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409459 Chr8:126001788..126001947 No primer for this exon
upstream ENSMUSE00000389561 Chr8:126004249..126004336 ATTTTCCCCGAGGCTGTATT Chr8:126004302..126004321 59.8 45

*** Putative Vector Insertion (Chr 8: 126004337 - 126004970) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000287472 Chr8:126004971..126005045 TGGGCTTGCACTTTTTCTGT Chr8:126005023..126005042 60.81 45
downstream ENSMUSE00000287446 Chr8:126008503..126008588 TTCCACCAGGGAAAATCATC Chr8:126008578..126008597 59.73 45
downstream ENSMUSE00000215327 Chr8:126009789..126009938 GAAGTCCTTGTCGTCCCAAG Chr8:126009821..126009840 59.7 55
downstream ENSMUSE00000287409 Chr8:126011259..126011327 AGATGTCGTCCCAGGAACAG Chr8:126011327..126011346 60.11 55
downstream ENSMUSE00000215316 Chr8:126012101..126012225 AGACTCGAGGTTCCGTTCAA Chr8:126012160..126012179 59.84 50
downstream ENSMUSE00000215325 Chr8:126013655..126013925 CTTGGCTGTTGTCTCACCAA Chr8:126013793..126013812 59.87 50
downstream ENSMUSE00000287348 Chr8:126016441..126016578 TGTTTTGCCAGTACCAGGTG Chr8:126016482..126016501 59.61 50
downstream ENSMUSE00000579443 Chr8:126016775..126016928 CTGCCAATTGCATCAATCTC Chr8:126016854..126016873 59.23 45
downstream ENSMUSE00000287304 Chr8:126017728..126017835 GCCGGCTAACACTACCACAT Chr8:126017768..126017787 60.02 55
downstream ENSMUSE00000215315 Chr8:126018706..126018831 GAAAGAGCGTCCTTGCTGAG Chr8:126018799..126018818 60.28 55
downstream ENSMUSE00000215341 Chr8:126022488..126022598 CTCCAATGACCCTCTCGATG Chr8:126022601..126022620 60.61 55
downstream ENSMUSE00000579440 Chr8:126023892..126024007 AGCCTCGTGGTAGGCTACAG Chr8:126023959..126023978 59.52 60
downstream ENSMUSE00000579439 Chr8:126025133..126025333 ATCATACACATGCGGTCGAA Chr8:126025239..126025258 59.96 45
downstream ENSMUSE00000633787 Chr8:126025133..126025333 ATCATACACATGCGGTCGAA Chr8:126025239..126025258 59.96 45
downstream ENSMUSE00000633768 Chr8:126025153..126025170 No primer for this exon
downstream ENSMUSE00000633767 Chr8:126025172..126025333 ATCATACACATGCGGTCGAA Chr8:126025239..126025258 59.96 45
downstream ENSMUSE00000215328 Chr8:126025415..126025609 TTGTCTGGGGAAGTCAAAGG Chr8:126025477..126025496 60.08 50
downstream ENSMUSE00000633786 Chr8:126025415..126025609 TTGTCTGGGGAAGTCAAAGG Chr8:126025477..126025496 60.08 50
downstream ENSMUSE00000341345 Chr8:126025748..126026076 ATCATGTCGGCTTTCTCCAG Chr8:126025800..126025819 60.22 50
downstream ENSMUSE00000633785 Chr8:126025748..126026076 ATCATGTCGGCTTTCTCCAG Chr8:126025800..126025819 60.22 50
downstream ENSMUSE00000706214 Chr8:126025748..126025966 ATCATGTCGGCTTTCTCCAG Chr8:126025800..126025819 60.22 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCCCAGAGGTACCGAAC Chr8:126004327..126004347 60.37 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTCCCAGAGGTACCGAAC Chr8:126004327..126004347 60.37 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031967