Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19299
Trapped Gene
Rcor2 (ENSMUSG00000024968)
Vector Insertion
Chr 19: 7346045 - 7347589
Public Clones not available
Private Clones OST395753 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000239443 (Chr19:7345829..7346044 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGGGCATGTACCTGAGT Chr19:7345932..7345951 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000239443 (Chr19:7345829..7346044 +)
Downstram Exon
ENSMUSE00000146721 (Chr19:7347590..7347667 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGGGCATGTACCTGAGT Chr19:7345932..7345951 59.99 55 GGCTGCTATTGGTCTGCTTC Chr19:7347623..7347642 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454289 Chr19:7341894..7341914 No primer for this exon
upstream ENSMUSE00000481800 Chr19:7343022..7343578 CTGCCTCTCGTAGCCTCAGT Chr19:7343328..7343347 59.77 60
upstream ENSMUSE00000711978 Chr19:7343341..7343578 GGGTAGGGTAATGCCCTCAG Chr19:7343442..7343461 60.7 60
upstream ENSMUSE00000713024 Chr19:7343341..7343578 GGGTAGGGTAATGCCCTCAG Chr19:7343442..7343461 60.7 60
upstream ENSMUSE00000621980 Chr19:7344255..7344311 AGTAATTCCGGAGTGCAAGC Chr19:7344289..7344308 59.34 50
upstream ENSMUSE00000621981 Chr19:7344255..7344311 AGTAATTCCGGAGTGCAAGC Chr19:7344289..7344308 59.34 50
upstream ENSMUSE00000239513 Chr19:7344591..7344671 TGCACGCTATAGCAACAAGG Chr19:7344598..7344617 60.04 50
upstream ENSMUSE00000146719 Chr19:7345044..7345096 No primer for this exon
upstream ENSMUSE00000550726 Chr19:7345188..7345349 GTGGCATAAACACGATGTGG Chr19:7345205..7345224 59.85 50
upstream ENSMUSE00000239457 Chr19:7345460..7345584 CTCCCTGACAAGGTGATTCC Chr19:7345460..7345479 59.51 55
upstream ENSMUSE00000454506 Chr19:7345683..7345752 GGAACCGGATACTGGAGACC Chr19:7345722..7345741 60.71 60
upstream ENSMUSE00000239443 Chr19:7345829..7346044 CCAAGGGCATGTACCTGAGT Chr19:7345932..7345951 59.99 55

*** Putative Vector Insertion (Chr 19: 7346045 - 7347589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146721 Chr19:7347590..7347667 GGCTGCTATTGGTCTGCTTC Chr19:7347623..7347642 59.99 55
downstream ENSMUSE00000146716 Chr19:7348323..7348380 AGCGGGAGTTGAACTTGGTA Chr19:7348350..7348369 59.73 50
downstream ENSMUSE00000146718 Chr19:7348510..7348739 CTGCAATAGCCCCAAAGTCT Chr19:7348551..7348570 59.34 50
downstream ENSMUSE00000363943 Chr19:7348833..7349714 GGGGTACTGATCGGGGTACT Chr19:7348881..7348900 60.07 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr19:7346095..7346115 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGACGTGACTGGGAAAAC Chr19:7346091..7346111 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024968