Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19367
Trapped Gene
Pou2f1 (ENSMUSG00000026565)
Vector Insertion
Chr 1: 167845295 - 167847052
Public Clones not available
Private Clones OST393305 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370820 (Chr1:167847053..167847153 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCTCGGACATCTTCACC Chr1:167847055..167847074 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370820 (Chr1:167847053..167847153 -)
Downstram Exon
ENSMUSE00000160566 (Chr1:167845241..167845294 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCTCGGACATCTTCACC Chr1:167847055..167847074 59.65 55 GACTGAGCAGCAGCCTGTAA Chr1:167845232..167845251 59.34 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711034 Chr1:167932693..167932765 AGGAGCAGCGAGTCAAGATG Chr1:167932723..167932742 60.7 55
upstream ENSMUSE00000720487 Chr1:167932693..167932765 AGGAGCAGCGAGTCAAGATG Chr1:167932723..167932742 60.7 55
upstream ENSMUSE00000492174 Chr1:167864935..167865031 CGCTACCTGTTCCTTCTTGC Chr1:167864999..167865018 60.01 55
upstream ENSMUSE00000593540 Chr1:167861793..167861858 GAGTGAAGATGCCAGCACAG Chr1:167861793..167861812 59.58 55
upstream ENSMUSE00000593541 Chr1:167861793..167861858 GAGTGAAGATGCCAGCACAG Chr1:167861793..167861812 59.58 55
upstream ENSMUSE00000370820 Chr1:167847053..167847153 CTTCCTCGGACATCTTCACC Chr1:167847055..167847074 59.65 55

*** Putative Vector Insertion (Chr 1: 167845295 - 167847052) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160566 Chr1:167845241..167845294 GACTGAGCAGCAGCCTGTAA Chr1:167845232..167845251 59.34 55
downstream ENSMUSE00000160578 Chr1:167843358..167843480 CGAATCTCCCGACTCTTCAC Chr1:167843429..167843448 59.8 55
downstream ENSMUSE00000160565 Chr1:167841419..167841607 TGCAATCTGTATGGGCTGAG Chr1:167841400..167841419 59.82 50
downstream ENSMUSE00000160582 Chr1:167839011..167839137 GCACCAACACAAACTGTTGC Chr1:167839052..167839071 60.21 50
downstream ENSMUSE00000379802 Chr1:167836816..167836910 AAAAGATTTTGCGCTTGCAG Chr1:167836864..167836883 60.51 40
downstream ENSMUSE00000226562 Chr1:167832271..167832444 TCAATTCGCTTTGGTGTTGA Chr1:167832343..167832362 60.23 40
downstream ENSMUSE00000536077 Chr1:167827756..167827897 GGTGGTTTGGCTGAAGTCAT Chr1:167827819..167827838 59.97 50
downstream ENSMUSE00000160572 Chr1:167826568..167826713 CTCTAAGGCCACACGGATGT Chr1:167826561..167826580 60.13 55
downstream ENSMUSE00000226538 Chr1:167825036..167825215 TCTTCCGAGGTAGGCTTTTG Chr1:167825171..167825190 59.45 50
downstream ENSMUSE00000226532 Chr1:167821941..167822046 AAAGGGAGGACAGGGTTGAC Chr1:167821954..167821973 60.35 55
downstream ENSMUSE00000226487 Chr1:167813178..167813249 TGCTGTGGTGGTGACTCTGT Chr1:167813157..167813176 60.37 55
downstream ENSMUSE00000500291 Chr1:167810261..167810606 GGAGAGGGACTCAAGGAAGG Chr1:167810485..167810504 60.19 60
downstream ENSMUSE00000358113 Chr1:167807108..167807196 TGCCAGTGTACTGTTGCTCA Chr1:167807096..167807115 59.03 50
downstream ENSMUSE00000687831 Chr1:167806034..167806107 ACAGAGGTGCAGTCACGATG Chr1:167806053..167806072 59.9 55
downstream ENSMUSE00000687828 Chr1:167805618..167805647 TCTCCAATCCATGAAGCAATC Chr1:167805605..167805625 60.03 42.86
downstream ENSMUSE00000335805 Chr1:167805616..167806179 ACAGAGGTGCAGTCACGATG Chr1:167806053..167806072 59.9 55
downstream ENSMUSE00000497207 Chr1:167805616..167806179 ACAGAGGTGCAGTCACGATG Chr1:167806053..167806072 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCCTCGGACATCTTCAC Chr1:167847054..167847074 59.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCCTCGGACATCTTCAC Chr1:167847054..167847074 59.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026565