Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19371
Trapped Gene
1500011H22Rik (ENSMUSG00000029463)
Vector Insertion
Chr 5: 122819648 - 122820523
Public Clones not available
Private Clones OST393142 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221631 (Chr5:122820524..122820582 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221631 (Chr5:122820524..122820582 -)
Downstram Exon
ENSMUSE00000221626 (Chr5:122819526..122819647 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGTTTGGCAATGTGTGCGTA Chr5:122819580..122819599 60.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221639 Chr5:122821892..122822330 TAGGGTGACAACCGAAGGTC Chr5:122822228..122822247 59.97 55
upstream ENSMUSE00000221631 Chr5:122820524..122820582 No primer for this exon

*** Putative Vector Insertion (Chr 5: 122819648 - 122820523) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221626 Chr5:122819526..122819647 AGTTTGGCAATGTGTGCGTA Chr5:122819580..122819599 60.18 45
downstream ENSMUSE00000221620 Chr5:122817608..122817737 TTCTGTGACCCGTGATGAAA Chr5:122817591..122817610 60.09 45
downstream ENSMUSE00000189093 Chr5:122817357..122817528 TCATATGGCCTCTGTGGTGA Chr5:122817477..122817496 60.07 50
downstream ENSMUSE00000189086 Chr5:122816323..122816405 TTCAGGGACTTGCATCTTGTT Chr5:122816339..122816359 59.73 42.86
downstream ENSMUSE00000338169 Chr5:122814595..122814928 CATGGTCCACTCTTCCCTGT Chr5:122814714..122814733 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCAGGTAATGCATGTGGA Chr5:122820508..122820528 59.15 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCAGGTAATGCATGTGGA Chr5:122820508..122820528 59.15 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029463