Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19380
Trapped Gene
Tor1aip2 (ENSMUSG00000050565)
Vector Insertion
Chr 1: 157888133 - 157888204
Public Clones not available
Private Clones OST392706 (lexicon) OST340276 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456853 (Chr1:157888020..157888132 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTAGTGGTACCGCTGATCC Chr1:157888078..157888097 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456853 (Chr1:157888020..157888132 +)
Downstram Exon
ENSMUSE00000716416 (Chr1:157888205..157888264 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTAGTGGTACCGCTGATCC Chr1:157888078..157888097 59.57 60 CGATTTCTGTTTGTGCCGTA Chr1:157888265..157888284 59.73 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332390 Chr1:157882533..157883238 CGAGAGCGAAGGTTGTAAGC Chr1:157883040..157883059 60.15 55
upstream ENSMUSE00000456853 Chr1:157888020..157888132 CCTAGTGGTACCGCTGATCC Chr1:157888078..157888097 59.57 60

*** Putative Vector Insertion (Chr 1: 157888133 - 157888204) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716416 Chr1:157888205..157888264 CGATTTCTGTTTGTGCCGTA Chr1:157888265..157888284 59.73 45
downstream ENSMUSE00000510270 Chr1:157898424..157898753 CTGATGGATCCGGTGAGTCT Chr1:157898620..157898639 60.07 55
downstream ENSMUSE00000688894 Chr1:157898713..157898753 No primer for this exon
downstream ENSMUSE00000364401 Chr1:157906541..157906717 CCACTGTCGCTCATGTTTGT Chr1:157906700..157906719 59.75 50
downstream ENSMUSE00000711357 Chr1:157906541..157906717 CCACTGTCGCTCATGTTTGT Chr1:157906700..157906719 59.75 50
downstream ENSMUSE00000339420 Chr1:157908718..157909299 AGCTCTGGCCCCTATTTCAT Chr1:157908866..157908885 60.06 50
downstream ENSMUSE00000375108 Chr1:157910723..157910824 ATCCTGTGCAACCTCTTGCT Chr1:157910787..157910806 59.87 50
downstream ENSMUSE00000341906 Chr1:157911831..157915991 TTGGCCATGATTCCTCTTTC Chr1:157913881..157913900 60.01 45
downstream ENSMUSE00000456846 Chr1:157911831..157912768 CCATCGCTAAGCTCCAAGTC Chr1:157912239..157912258 59.98 55
downstream ENSMUSE00000688892 Chr1:157911831..157915987 TTGGCCATGATTCCTCTTTC Chr1:157913881..157913900 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTACCGCTGATCCTGACTG Chr1:157888085..157888105 60.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTACCGCTGATCCTGACTG Chr1:157888085..157888105 60.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050565