Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19402
Trapped Gene
Stk38 (ENSMUSG00000024006)
Vector Insertion
Chr 17: 29129414 - 29136953
Public Clones IST14724A5 (tigm)
Private Clones OST391983 (lexicon) OST380827 (lexicon) OST232552 (lexicon) OST230710 (lexicon)
OST219223 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238312 (Chr17:29136954..29137086 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238312 (Chr17:29136954..29137086 -)
Downstram Exon
ENSMUSE00000238301 (Chr17:29129362..29129413 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50 TCTTCGTCTTTCAGGCCTTC Chr17:29129341..29129360 59.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431121 Chr17:29144656..29144882 GCAGTTGGGGTTCTTCCTTT Chr17:29144795..29144814 60.48 50
upstream ENSMUSE00000238312 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000710202 Chr17:29136954..29137089 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000711234 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50

*** Putative Vector Insertion (Chr 17: 29129414 - 29136953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238301 Chr17:29129362..29129413 TCTTCGTCTTTCAGGCCTTC Chr17:29129341..29129360 59.55 50
downstream ENSMUSE00000137178 Chr17:29128243..29128365 GCGGATCTTCTGAGTCGTTT Chr17:29128324..29128343 59.43 50
downstream ENSMUSE00000137194 Chr17:29125123..29125206 CTTTGCGCAGGATTTTCATT Chr17:29125124..29125143 60.21 40
downstream ENSMUSE00000137186 Chr17:29121022..29121145 CACAAACTGTCTGCCTCCAC Chr17:29121071..29121090 59.31 55
downstream ENSMUSE00000137185 Chr17:29118977..29119131 TGCTGTCCAAGAGAAGGTTG Chr17:29118957..29118976 59.01 50
downstream ENSMUSE00000549113 Chr17:29117330..29117467 CCTCATGGCACAGCAAGTAA Chr17:29117383..29117402 59.86 50
downstream ENSMUSE00000137179 Chr17:29116148..29116250 AAAGGCCAAAGTCGGAAAGT Chr17:29116198..29116217 60.11 45
downstream ENSMUSE00000137183 Chr17:29114485..29114546 GCTGGCGTCTGTTTCTTTTC Chr17:29114465..29114484 60 50
downstream ENSMUSE00000137192 Chr17:29112764..29112881 TGTAACCCGTCTGCATGAAC Chr17:29112796..29112815 59.57 50
downstream ENSMUSE00000137180 Chr17:29111491..29111614 ATGTCTCTTGTGGGGTCTCG Chr17:29111554..29111573 60.11 55
downstream ENSMUSE00000238116 Chr17:29111227..29111322 AGGGGCTCCGATTCTATGTT Chr17:29111264..29111283 59.92 50
downstream ENSMUSE00000137176 Chr17:29109990..29110084 No primer for this exon
downstream ENSMUSE00000717891 Chr17:29109182..29109621 AGGCCCTATTTTGCTGCTTT Chr17:29109464..29109483 60.22 45
downstream ENSMUSE00000408447 Chr17:29107830..29109621 TAGGCAGTGTGTGCCTCAAG Chr17:29108677..29108696 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTCAACATGAAGAACGAG Chr17:29136959..29136979 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTCAACATGAAGAACGAG Chr17:29136959..29136979 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TACTAATCGCCTTGCAGCAC Chr17:29134019..29134039 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CATGGCAATGACAGGATCAA Chr17:29131064..29131084 60.48 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024006