Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19421
Trapped Gene
Ccdc57 (ENSMUSG00000048445)
Vector Insertion
Chr 11: 120783249 - 120794029
Public Clones 5SE284F05 (ggtc) 3SE284F05 (ggtc)
Private Clones OST391433 (lexicon) OST356170 (lexicon) OST242007 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512694 (Chr11:120794030..120794186 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGAGACGAAGCTAATTCC Chr11:120794054..120794073 61.08 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512694 (Chr11:120794030..120794186 -)
Downstram Exon
ENSMUSE00000401898 (Chr11:120782834..120783248 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGAGACGAAGCTAATTCC Chr11:120794054..120794073 61.08 55 CTCAACATCATAGCGCTCCA Chr11:120782988..120783007 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512694 Chr11:120794030..120794186 CGGGAGACGAAGCTAATTCC Chr11:120794054..120794073 61.08 55

*** Putative Vector Insertion (Chr 11: 120783249 - 120794029) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401898 Chr11:120782834..120783248 CTCAACATCATAGCGCTCCA Chr11:120782988..120783007 59.97 50
downstream ENSMUSE00000366049 Chr11:120780787..120780895 CCAGTTCGCTGTTCTTGTCA Chr11:120780854..120780873 60.03 50
downstream ENSMUSE00000409661 Chr11:120765298..120765399 No primer for this exon
downstream ENSMUSE00000406389 Chr11:120764837..120764994 TCCAGCGTCTCTCAGAGCTT Chr11:120764928..120764947 60.43 55
downstream ENSMUSE00000371022 Chr11:120764630..120764704 GCTTCTTCTCCAAGCCCTTT Chr11:120764660..120764679 59.96 50
downstream ENSMUSE00000414005 Chr11:120763189..120763389 GAACTGAAGCTCCAGCACCT Chr11:120763253..120763272 59.6 55
downstream ENSMUSE00000367026 Chr11:120759123..120759281 GCAGCGTGTGAATCTGAAAG Chr11:120759159..120759178 59.6 50
downstream ENSMUSE00000407738 Chr11:120756571..120756733 CTGTACCTGTTCACGCTCCA Chr11:120756648..120756667 59.9 55
downstream ENSMUSE00000380530 Chr11:120755913..120756047 TAGCTTGGTCTCGCTCCAGT Chr11:120755938..120755957 60.16 55
downstream ENSMUSE00000337249 Chr11:120747164..120747377 AGATGACCGCTCAGCATCTC Chr11:120747216..120747235 60.53 55
downstream ENSMUSE00000383238 Chr11:120746547..120746699 CTGCTTCAAGGGTCAGAACA Chr11:120746654..120746673 59.01 50
downstream ENSMUSE00000396036 Chr11:120743129..120743229 TGCAGTGGATGTCTGGTCTG Chr11:120743176..120743195 60.9 55
downstream ENSMUSE00000368661 Chr11:120740192..120740362 GGGTGTCACCTTGAGATGCT Chr11:120740209..120740228 60.12 55
downstream ENSMUSE00000356044 Chr11:120734900..120735113 AGTAGGGGACTCCGTCTGGT Chr11:120735038..120735057 59.99 60
downstream ENSMUSE00000337295 Chr11:120727869..120727990 GAGTAGGGCTGCAATTGTCC Chr11:120727857..120727876 59.7 55
downstream ENSMUSE00000309042 Chr11:120722452..120722583 TGAGTGGGGTTGACTCTTCC Chr11:120722499..120722518 60.09 55
downstream ENSMUSE00000414877 Chr11:120721715..120721940 AAGACGATCTGTGGGTACGG Chr11:120721786..120721805 59.99 55
downstream ENSMUSE00000414924 Chr11:120687856..120688238 CTTTTGGCTGAGCTTCCATC Chr11:120688106..120688125 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCTGAAATGCACTCTTGGT Chr11:120785056..120785077 59.34 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTGAAATGCACTCTTGGT Chr11:120785056..120785077 59.34 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGCCCTGTCCTAGGTGATTC Chr11:120785139..120785159 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCCCTGTCCTAGGTGATTC Chr11:120785139..120785159 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048445