Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19431
Trapped Gene
Wasf1 (ENSMUSG00000019831)
Vector Insertion
Chr 10: 40640215 - 40646289
Public Clones not available
Private Clones OST391281 (lexicon) OST232899 (lexicon) OST217601 (lexicon) OST67934 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398335 (Chr10:40640054..40640214 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398335 (Chr10:40640054..40640214 +)
Downstram Exon
ENSMUSE00000098383 (Chr10:40646290..40646424 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644055 Chr10:40603379..40603415 No primer for this exon
upstream ENSMUSE00000666475 Chr10:40603633..40603876 No primer for this exon
upstream ENSMUSE00000398335 Chr10:40640054..40640214 No primer for this exon
upstream ENSMUSE00000713337 Chr10:40640054..40640214 No primer for this exon

*** Putative Vector Insertion (Chr 10: 40640215 - 40646289) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098383 Chr10:40646290..40646424 No primer for this exon
downstream ENSMUSE00000299241 Chr10:40650437..40650590 No primer for this exon
downstream ENSMUSE00000299233 Chr10:40651722..40651839 No primer for this exon
downstream ENSMUSE00000299224 Chr10:40652919..40653091 No primer for this exon
downstream ENSMUSE00000299218 Chr10:40654283..40654462 No primer for this exon
downstream ENSMUSE00000098386 Chr10:40655916..40656544 No primer for this exon
downstream ENSMUSE00000406624 Chr10:40657452..40658373 No primer for this exon
downstream ENSMUSE00000666474 Chr10:40657452..40658376 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCAAATGCAACAGACAG Chr10:40646211..40646231 60.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCAAATGCAACAGACAG Chr10:40646211..40646231 60.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019831