Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19433
Trapped Gene
AC158589.7 (ENSMUSG00000059179)
Vector Insertion
Chr 5: 16236894 - 16238758
Public Clones not available
Private Clones OST391268 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702294 (Chr5:16238759..16238781 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702294 (Chr5:16238759..16238781 -)
Downstram Exon
ENSMUSE00000480451 (Chr5:16236470..16236893 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTCTGGTTCCTTTGGATCA Chr5:16236840..16236859 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702294 Chr5:16238759..16238781 No primer for this exon

*** Putative Vector Insertion (Chr 5: 16236894 - 16238758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480451 Chr5:16236470..16236893 GCTCTGGTTCCTTTGGATCA Chr5:16236840..16236859 60.19 50
downstream ENSMUSE00000470559 Chr5:16236211..16236453 TCCTCCACGACCAAAGTTTC Chr5:16236198..16236217 60.09 50
downstream ENSMUSE00000553061 Chr5:16235811..16236035 CACCACTTCCACCTCCAGAT Chr5:16235812..16235831 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTGCCTATGCCTGGTTTC Chr5:16238717..16238737 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTGCCTATGCCTGGTTTC Chr5:16238717..16238737 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059179