Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19434
Trapped Gene
Cdk7 (ENSMUSG00000069089)
Vector Insertion
Chr 13: 101486575 - 101487526
Public Clones IST13337D6 (tigm)
Private Clones OST391264 (lexicon) OST345152 (lexicon) OST301638 (lexicon) OST240364 (lexicon)
OST108130 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569283 (Chr13:101487527..101487637 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGATAACAGCCTTGTGCTGA Chr13:101487607..101487627 59.89 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569283 (Chr13:101487527..101487637 -)
Downstram Exon
ENSMUSE00000569281 (Chr13:101486456..101486574 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGATAACAGCCTTGTGCTGA Chr13:101487607..101487627 59.89 47.62 GCCAAAATCTGCCAGTTTCA Chr13:101486490..101486509 61.15 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569295 Chr13:101500729..101500878 TCGGACGCTTTAAATTCCTG Chr13:101500843..101500862 60.2 45
upstream ENSMUSE00000569293 Chr13:101500413..101500472 ACCAAATCGTCGCCATTAAG Chr13:101500416..101500435 59.96 45
upstream ENSMUSE00000569289 Chr13:101492635..101492668 No primer for this exon
upstream ENSMUSE00000569288 Chr13:101490541..101490608 No primer for this exon
upstream ENSMUSE00000569286 Chr13:101489257..101489325 CTCCTTGATGCATTTGGACAT Chr13:101489305..101489325 59.95 42.86
upstream ENSMUSE00000569283 Chr13:101487527..101487637 AGGATAACAGCCTTGTGCTGA Chr13:101487607..101487627 59.89 47.62

*** Putative Vector Insertion (Chr 13: 101486575 - 101487526) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569281 Chr13:101486456..101486574 GCCAAAATCTGCCAGTTTCA Chr13:101486490..101486509 61.15 45
downstream ENSMUSE00000569278 Chr13:101481452..101481551 CCCACATGTCTACTCCCACA Chr13:101481465..101481484 59.39 55
downstream ENSMUSE00000569276 Chr13:101480029..101480115 TCTCCAGGCAAAAATGGAAC Chr13:101480074..101480093 60.05 45
downstream ENSMUSE00000569275 Chr13:101476322..101476471 AAGAACAGGCCTTGGATGAG Chr13:101476334..101476353 59.28 50
downstream ENSMUSE00000569272 Chr13:101474346..101474493 TCTGCTCTTTTCCGCTTTGT Chr13:101474338..101474357 60.13 45
downstream ENSMUSE00000640048 Chr13:101473270..101473461 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATTAATCGCCTTGCAGCAC Chr13:101487458..101487479 59.76 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCTTTGTATCGTGACTGG Chr13:101487466..101487487 58.44 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGATAACAGCCTTGTGCTGA Chr13:101487605..101487626 59.89 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGATAACAGCCTTGTGCTGA Chr13:101487605..101487626 59.89 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069089