Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19435
Trapped Gene
Nmi (ENSMUSG00000026946)
Vector Insertion
Chr 2: 51808403 - 51811445
Public Clones not available
Private Clones OST391194 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164563 (Chr2:51811446..51811608 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCGCTCATCACCTTTGAG Chr2:51811456..51811475 60.54 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164563 (Chr2:51811446..51811608 -)
Downstram Exon
ENSMUSE00000164567 (Chr2:51808296..51808402 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCGCTCATCACCTTTGAG Chr2:51811456..51811475 60.54 50 CATCTGCACGACATGATTCC Chr2:51808337..51808356 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164566 Chr2:51828494..51828616 ATGGAGCAGAAGCATCCTGT Chr2:51828555..51828574 59.83 50
upstream ENSMUSE00000692805 Chr2:51828429..51828523 GTCGCTGAAGCCAGGTTAGT Chr2:51828488..51828507 59.5 55
upstream ENSMUSE00000164572 Chr2:51816091..51816180 GGACGATATGAGAGGCGAAC Chr2:51816099..51816118 59.66 55
upstream ENSMUSE00000709758 Chr2:51816091..51816180 GGACGATATGAGAGGCGAAC Chr2:51816099..51816118 59.66 55
upstream ENSMUSE00000164569 Chr2:51814417..51814512 AGCTGAATTGCAGTCGGATG Chr2:51814431..51814450 61.35 50
upstream ENSMUSE00000164563 Chr2:51811446..51811608 AAGCGCTCATCACCTTTGAG Chr2:51811456..51811475 60.54 50

*** Putative Vector Insertion (Chr 2: 51808403 - 51811445) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164567 Chr2:51808296..51808402 CATCTGCACGACATGATTCC Chr2:51808337..51808356 60.08 50
downstream ENSMUSE00000164570 Chr2:51807962..51808148 ATGACAGCGCTTCTGGACTT Chr2:51807960..51807979 60.02 50
downstream ENSMUSE00000164574 Chr2:51805504..51805610 AACAGCAACGCTATGGCACT Chr2:51805518..51805537 60.86 50
downstream ENSMUSE00000164576 Chr2:51804025..51804296 CTTCCGTTGGAAGTGGATGT Chr2:51804167..51804186 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCGCTCATCACCTTTGAGA Chr2:51811453..51811473 61.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAAGCATCCGCACGTGACT Chr2:51811387..51811407 60.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026946