Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19443
Trapped Gene
Rbm4 (ENSMUSG00000056951)
Vector Insertion
Chr 19: 4792821 - 4793671
Public Clones not available
Private Clones OST391058 (lexicon) OST234076 (lexicon) OST132262 (lexicon) OST44780 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000250866 (Chr19:4793672..4793877 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGTGAGATACTCCACGTT Chr19:4793799..4793818 60.14 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000250866 (Chr19:4793672..4793877 -)
Downstram Exon
ENSMUSE00000250851 (Chr19:4792398..4792820 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGTGAGATACTCCACGTT Chr19:4793799..4793818 60.14 55 GTAGTGGTGCAGGTTGCGTA Chr19:4792614..4792633 59.79 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000250866 Chr19:4793672..4793877 GCGGTGAGATACTCCACGTT Chr19:4793799..4793818 60.14 55

*** Putative Vector Insertion (Chr 19: 4792821 - 4793671) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000250851 Chr19:4792398..4792820 GTAGTGGTGCAGGTTGCGTA Chr19:4792614..4792633 59.79 55
downstream ENSMUSE00000250822 Chr19:4787361..4788042 TACGCACTGCTCCATATTGC Chr19:4787838..4787857 59.86 50
downstream ENSMUSE00000622604 Chr19:4784299..4785567 CCCAAATCCAATACCCACTG Chr19:4785236..4785255 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTCCTCCAAGTCCTCGT Chr19:4793636..4793656 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTTCCTCCAAGTCCTCGT Chr19:4793636..4793656 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056951