Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19447
Trapped Gene
Adrbk1 (ENSMUSG00000024858)
Vector Insertion
Chr 19: 4294849 - 4294927
Public Clones not available
Private Clones OST391013 (lexicon) OST313521 (lexicon) OST230379 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000622631 (Chr19:4294850..4294926 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCGAGGAGAAGTGACCT Chr19:4294877..4294896 60.65 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000622631 (Chr19:4294850..4294926 -)
Downstram Exon
ENSMUSE00000622630 (Chr19:4294850..4294926 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCGAGGAGAAGTGACCT Chr19:4294877..4294896 60.65 60 GGTCACTTCTCCTCGGTCCT Chr19:4294856..4294875 60.65 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471067 Chr19:4305902..4305955 AAGAAGATCCTGCTGCCAGA Chr19:4305908..4305927 60.1 50
upstream ENSMUSE00000709370 Chr19:4305902..4306222 AAGAAGATCCTGCTGCCAGA Chr19:4305908..4305927 60.1 50
upstream ENSMUSE00000710847 Chr19:4305902..4306222 AAGAAGATCCTGCTGCCAGA Chr19:4305908..4305927 60.1 50
upstream ENSMUSE00000468089 Chr19:4305122..4305193 AACTGATGTCATCGCACCTG Chr19:4305122..4305141 59.71 50
upstream ENSMUSE00000622630 Chr19:4294850..4294926 GGACCGAGGAGAAGTGACCT Chr19:4294877..4294896 60.65 60
upstream ENSMUSE00000622631 Chr19:4294850..4294926 GGACCGAGGAGAAGTGACCT Chr19:4294877..4294896 60.65 60

*** Putative Vector Insertion (Chr 19: 4294849 - 4294927) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145615 Chr19:4292767..4292840 CCAGATGGTTCAGGCAGAAG Chr19:4292780..4292799 60.79 55
downstream ENSMUSE00000145632 Chr19:4292544..4292645 ACCACACGTTCCTCCTCTGT Chr19:4292580..4292599 59.6 55
downstream ENSMUSE00000145622 Chr19:4292362..4292436 TGCTCCGTAGCATTCTTTGA Chr19:4292389..4292408 59.57 45
downstream ENSMUSE00000145634 Chr19:4292170..4292231 CCTCGGAGGTTCTGACAAAT Chr19:4292175..4292194 59.14 50
downstream ENSMUSE00000145625 Chr19:4291590..4291641 ACTGGCAGAACCGTGTGAAC Chr19:4291594..4291613 61.18 55
downstream ENSMUSE00000554209 Chr19:4291239..4291330 TCTTGCCTGTGTCTGCTTTC Chr19:4291218..4291237 59.17 50
downstream ENSMUSE00000554198 Chr19:4290772..4290871 CTTGATGCGTTTCTTGTCCA Chr19:4290813..4290832 59.84 45
downstream ENSMUSE00000554191 Chr19:4290604..4290682 AGGTCCAGGATGAAGCTGAG Chr19:4290590..4290609 59.4 55
downstream ENSMUSE00000554184 Chr19:4290395..4290525 AAGCGATTGTGCATGTGTTC Chr19:4290395..4290414 59.73 45
downstream ENSMUSE00000554180 Chr19:4290074..4290168 GGTCCGAGATTCTCACATGG Chr19:4290098..4290117 60.47 55
downstream ENSMUSE00000554174 Chr19:4289898..4290005 TCTGCACTGCTGTCATAGGC Chr19:4289918..4289937 60.17 55
downstream ENSMUSE00000145612 Chr19:4289673..4289739 ATGCGGTCAATCTCATGCTT Chr19:4289664..4289683 60.63 45
downstream ENSMUSE00000145624 Chr19:4289313..4289413 AGCCTAGTCTCCGATTGACG Chr19:4289304..4289323 59.45 55
downstream ENSMUSE00000145613 Chr19:4288592..4288658 CAGTCCAGGGAACGAAAGAA Chr19:4288592..4288611 60.22 50
downstream ENSMUSE00000145621 Chr19:4288412..4288507 TCCTCATCAAAGGAGCCAAT Chr19:4288409..4288428 59.63 45
downstream ENSMUSE00000246822 Chr19:4287823..4287985 GTTGCGGTACAGTTCCTGGT Chr19:4287931..4287950 60.03 55
downstream ENSMUSE00000145626 Chr19:4287558..4287694 CAGTCCTTACCCAGGGCATA Chr19:4287651..4287670 59.95 55
downstream ENSMUSE00000145619 Chr19:4287353..4287466 CACTTGCGTTCCTTGATCTG Chr19:4287380..4287399 59.44 50
downstream ENSMUSE00000514948 Chr19:4286002..4287264 GCTTTGCGGGAAAACAAATA Chr19:4286988..4287007 60.08 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000024858