Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19451
Trapped Gene
Rnf38 (ENSMUSG00000035696)
Vector Insertion
Chr 4: 44165231 - 44165426
Public Clones not available
Private Clones OST390961 (lexicon) OST275985 (lexicon) OST240345 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000527488 (Chr4:44165232..44165425 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAACGCTGTAACACACCT Chr4:44165249..44165268 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000527488 (Chr4:44165232..44165425 -)
Downstram Exon
ENSMUSE00000660803 (Chr4:44165232..44165425 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAACGCTGTAACACACCT Chr4:44165249..44165268 60.03 55 GTTGCGTGCAGGTGTGTTAC Chr4:44165218..44165237 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000527467 Chr4:44181115..44181211 No primer for this exon
upstream ENSMUSE00000674574 Chr4:44180499..44180823 GGCGAGCAGTCACAATAGGA Chr4:44180559..44180578 61.35 55
upstream ENSMUSE00000632786 Chr4:44180190..44180387 ACGCAGGTGAAGTGATGATG Chr4:44180324..44180343 59.71 50
upstream ENSMUSE00000419583 Chr4:44171775..44171924 GGCCAATTCAGCACCTCTAC Chr4:44171894..44171913 59.7 55
upstream ENSMUSE00000674573 Chr4:44171775..44171815 CCATTCAAGAGGATGCTCACT Chr4:44171792..44171812 59.3 47.62
upstream ENSMUSE00000674571 Chr4:44167513..44167605 TTCAGTCGTTTTCTGAGTTTGG Chr4:44167571..44167592 59.4 40.91
upstream ENSMUSE00000527488 Chr4:44165232..44165425 GGGAACGCTGTAACACACCT Chr4:44165249..44165268 60.03 55
upstream ENSMUSE00000660803 Chr4:44165232..44165425 GGGAACGCTGTAACACACCT Chr4:44165249..44165268 60.03 55

*** Putative Vector Insertion (Chr 4: 44165231 - 44165426) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000527485 Chr4:44161897..44162110 GGATGTAACAGACGGGGAGA Chr4:44161927..44161946 59.93 55
downstream ENSMUSE00000527483 Chr4:44156320..44156487 CACACTACAGACGGGGAGGT Chr4:44156307..44156326 60.03 60
downstream ENSMUSE00000527480 Chr4:44155167..44155337 CGATCGTGACTGCTGTGTTT Chr4:44155145..44155164 59.9 50
downstream ENSMUSE00000527478 Chr4:44151542..44151703 CTCCTGATGCAAAGGGTCAT Chr4:44151535..44151554 60.07 50
downstream ENSMUSE00000527475 Chr4:44150427..44150533 GCTGCTGGGATCGGTATCTA Chr4:44150451..44150470 60.2 55
downstream ENSMUSE00000527473 Chr4:44147762..44147846 GCAGGTGGTACTGGAAGCAT Chr4:44147801..44147820 60.14 55
downstream ENSMUSE00000527471 Chr4:44146512..44146633 TCTCCGCCAAGTTTAACAGG Chr4:44146590..44146609 60.24 50
downstream ENSMUSE00000373638 Chr4:44144416..44144515 GGCATGGAACTCGTGGTTAC Chr4:44144418..44144437 60.38 55
downstream ENSMUSE00000674570 Chr4:44142292..44142528 AGGCTGGTCACTCTGAATCG Chr4:44142437..44142456 60.41 55
downstream ENSMUSE00000632785 Chr4:44139087..44142528 GTGTGAAGAGGCCCAAATGT Chr4:44139460..44139479 59.97 50
downstream ENSMUSE00000488423 Chr4:44139085..44142528 GTGTGAAGAGGCCCAAATGT Chr4:44139460..44139479 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACAGCGCCTCTCTCATTC Chr4:44165380..44165400 59.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACAGCGCCTCTCTCATTC Chr4:44165380..44165400 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035696