Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19466
Trapped Gene
Nup188 (ENSMUSG00000052533)
Vector Insertion
Chr 2: 30153935 - 30154010
Public Clones not available
Private Clones OST390708 (lexicon) OST339476 (lexicon) OST334171 (lexicon) OST274614 (lexicon)
OST268419 (lexicon) OST254235 (lexicon) OST251699 (lexicon) OST231827 (lexicon)
OST218033 (lexicon) OST179263 (lexicon) OST169222 (lexicon) OST94700 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387349 (Chr2:30153936..30154009 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAGATTGAGGCGGAACTG Chr2:30153937..30153956 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387349 (Chr2:30153936..30154009 +)
Downstram Exon
ENSMUSE00000696484 (Chr2:30153936..30154009 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAGATTGAGGCGGAACTG Chr2:30153937..30153956 60.22 50 TTCTAACAACCGCTGCCAAT Chr2:30153986..30154005 60.64 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696496 Chr2:30141949..30141990 No primer for this exon
upstream ENSMUSE00000713746 Chr2:30141953..30141990 No primer for this exon
upstream ENSMUSE00000718076 Chr2:30141953..30141990 No primer for this exon
upstream ENSMUSE00000344614 Chr2:30152168..30152222 No primer for this exon
upstream ENSMUSE00000696487 Chr2:30152168..30152222 No primer for this exon

*** Putative Vector Insertion (Chr 2: 30153935 - 30154010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000387349 Chr2:30153936..30154009 TTCTAACAACCGCTGCCAAT Chr2:30153986..30154005 60.64 45
downstream ENSMUSE00000696484 Chr2:30153936..30154009 TTCTAACAACCGCTGCCAAT Chr2:30153986..30154005 60.64 45
downstream ENSMUSE00000351998 Chr2:30156320..30156404 GACTCTTAGGCCCAGCTCCT Chr2:30156395..30156414 59.98 60
downstream ENSMUSE00000696480 Chr2:30156320..30156404 GACTCTTAGGCCCAGCTCCT Chr2:30156395..30156414 59.98 60
downstream ENSMUSE00000378656 Chr2:30156529..30156609 CCCGAGTACCCCTGTAATCC Chr2:30156601..30156620 60.57 60
downstream ENSMUSE00000696477 Chr2:30156529..30156609 CCCGAGTACCCCTGTAATCC Chr2:30156601..30156620 60.57 60
downstream ENSMUSE00000450871 Chr2:30157521..30157565 CTGGCTCTGCCTCTCATCTT Chr2:30157553..30157572 59.7 55
downstream ENSMUSE00000696474 Chr2:30157521..30157565 CTGGCTCTGCCTCTCATCTT Chr2:30157553..30157572 59.7 55
downstream ENSMUSE00000696493 Chr2:30159180..30159275 GGTAAGGCATTCCTGAGCTG Chr2:30159232..30159251 59.84 55
downstream ENSMUSE00000284835 Chr2:30159577..30159669 ATGGCGTTCATCTTGGAAAT Chr2:30159663..30159682 59.39 40
downstream ENSMUSE00000696472 Chr2:30159577..30159669 ATGGCGTTCATCTTGGAAAT Chr2:30159663..30159682 59.39 40
downstream ENSMUSE00000284825 Chr2:30159802..30159921 No primer for this exon
downstream ENSMUSE00000696470 Chr2:30159802..30159921 No primer for this exon
downstream ENSMUSE00000284814 Chr2:30163041..30163252 AAACCCTTGCTCCTTGAACA Chr2:30163190..30163209 59.71 45
downstream ENSMUSE00000696468 Chr2:30163041..30163252 AAACCCTTGCTCCTTGAACA Chr2:30163190..30163209 59.71 45
downstream ENSMUSE00000284804 Chr2:30164739..30164853 TCATCCAAGGCGTACTTGTG Chr2:30164810..30164829 59.72 50
downstream ENSMUSE00000696467 Chr2:30164739..30164853 TCATCCAAGGCGTACTTGTG Chr2:30164810..30164829 59.72 50
downstream ENSMUSE00000401623 Chr2:30165398..30165598 TCTTCCTGACCACACTGCTG Chr2:30165521..30165540 60.02 55
downstream ENSMUSE00000696465 Chr2:30165398..30165598 TCTTCCTGACCACACTGCTG Chr2:30165521..30165540 60.02 55
downstream ENSMUSE00000284797 Chr2:30168120..30168209 AGTGTGTGCAGCTCCAGTGA Chr2:30168199..30168218 60.69 55
downstream ENSMUSE00000696463 Chr2:30168120..30168209 AGTGTGTGCAGCTCCAGTGA Chr2:30168199..30168218 60.69 55
downstream ENSMUSE00000284790 Chr2:30170636..30170701 GAACAGCTCTGGAAGGGAAG Chr2:30170695..30170714 59.01 55
downstream ENSMUSE00000696461 Chr2:30170636..30170701 GAACAGCTCTGGAAGGGAAG Chr2:30170695..30170714 59.01 55
downstream ENSMUSE00000351620 Chr2:30172008..30172127 AGAATGATCCCGAGACCAGA Chr2:30172039..30172058 59.61 50
downstream ENSMUSE00000696460 Chr2:30172008..30172127 AGAATGATCCCGAGACCAGA Chr2:30172039..30172058 59.61 50
downstream ENSMUSE00000284715 Chr2:30172701..30172827 ATCATGGGGCTTGTGCTTAT Chr2:30172766..30172785 59.42 45
downstream ENSMUSE00000696459 Chr2:30172701..30172827 ATCATGGGGCTTGTGCTTAT Chr2:30172766..30172785 59.42 45
downstream ENSMUSE00000284709 Chr2:30177402..30177554 AAGAGTACTCCCAGCGGACA Chr2:30177494..30177513 59.87 55
downstream ENSMUSE00000696458 Chr2:30177402..30177554 AAGAGTACTCCCAGCGGACA Chr2:30177494..30177513 59.87 55
downstream ENSMUSE00000284700 Chr2:30177692..30177818 AATCAATGATGGGCTTGACC Chr2:30177736..30177755 59.76 45
downstream ENSMUSE00000696457 Chr2:30177692..30177818 AATCAATGATGGGCTTGACC Chr2:30177736..30177755 59.76 45
downstream ENSMUSE00000284690 Chr2:30178006..30178093 GCAGCCAAGACAGTTAAGCA Chr2:30178080..30178099 59.22 50
downstream ENSMUSE00000696456 Chr2:30178006..30178093 GCAGCCAAGACAGTTAAGCA Chr2:30178080..30178099 59.22 50
downstream ENSMUSE00000284683 Chr2:30178191..30178267 TGTGTGACGAAGATCAGTCCA Chr2:30178216..30178236 60.3 47.62
downstream ENSMUSE00000696453 Chr2:30178191..30178267 TGTGTGACGAAGATCAGTCCA Chr2:30178216..30178236 60.3 47.62
downstream ENSMUSE00000284675 Chr2:30179040..30179154 CATCAGAAGGCTGCCATACC Chr2:30179085..30179104 60.62 55
downstream ENSMUSE00000696452 Chr2:30179040..30179154 CATCAGAAGGCTGCCATACC Chr2:30179085..30179104 60.62 55
downstream ENSMUSE00000284665 Chr2:30180748..30180868 TTGTAGCGCCATTTGTGGTA Chr2:30180845..30180864 60.13 45
downstream ENSMUSE00000696451 Chr2:30180748..30180868 TTGTAGCGCCATTTGTGGTA Chr2:30180845..30180864 60.13 45
downstream ENSMUSE00000284656 Chr2:30180993..30181059 TGGCACAGGTTCAGTATTGC Chr2:30181041..30181060 59.72 50
downstream ENSMUSE00000696450 Chr2:30180993..30181059 TGGCACAGGTTCAGTATTGC Chr2:30181041..30181060 59.72 50
downstream ENSMUSE00000344490 Chr2:30181970..30182098 TGCTAATGACGGTCTGTCCA Chr2:30182046..30182065 60.26 50
downstream ENSMUSE00000696448 Chr2:30181970..30182098 TGCTAATGACGGTCTGTCCA Chr2:30182046..30182065 60.26 50
downstream ENSMUSE00000470054 Chr2:30182968..30183107 AACGCCAGCTTCACTGTCTT Chr2:30183030..30183049 60.06 50
downstream ENSMUSE00000696446 Chr2:30182968..30183107 AACGCCAGCTTCACTGTCTT Chr2:30183030..30183049 60.06 50
downstream ENSMUSE00000472889 Chr2:30184827..30184933 GGCTAGGACAGCAATGAGGT Chr2:30184864..30184883 59.31 55
downstream ENSMUSE00000696445 Chr2:30184827..30184933 GGCTAGGACAGCAATGAGGT Chr2:30184864..30184883 59.31 55
downstream ENSMUSE00000471957 Chr2:30186077..30186283 GCTGTGTCTCTACCGCCACT Chr2:30186227..30186246 60.48 60
downstream ENSMUSE00000696444 Chr2:30186077..30186283 GCTGTGTCTCTACCGCCACT Chr2:30186227..30186246 60.48 60
downstream ENSMUSE00000474783 Chr2:30186367..30186536 ATAGCTGCACGATGCAACAG Chr2:30186476..30186495 60.04 50
downstream ENSMUSE00000696443 Chr2:30186367..30186536 ATAGCTGCACGATGCAACAG Chr2:30186476..30186495 60.04 50
downstream ENSMUSE00000473792 Chr2:30187905..30187974 GTTCCAAACAGCGGACTTGT Chr2:30187949..30187968 60.16 50
downstream ENSMUSE00000696441 Chr2:30187905..30187974 GTTCCAAACAGCGGACTTGT Chr2:30187949..30187968 60.16 50
downstream ENSMUSE00000507307 Chr2:30188340..30188407 TCTTCATGATCAGGGCACAG Chr2:30188379..30188398 59.79 50
downstream ENSMUSE00000696439 Chr2:30188340..30188407 TCTTCATGATCAGGGCACAG Chr2:30188379..30188398 59.79 50
downstream ENSMUSE00000509991 Chr2:30188790..30188985 GCCAAAGACTTGACGTACCC Chr2:30188885..30188904 59.6 55
downstream ENSMUSE00000696438 Chr2:30188790..30188985 GCCAAAGACTTGACGTACCC Chr2:30188885..30188904 59.6 55
downstream ENSMUSE00000509070 Chr2:30191844..30191921 AATGCTTTGGTCCCATCAAG Chr2:30191923..30191942 59.93 45
downstream ENSMUSE00000696437 Chr2:30191844..30191921 AATGCTTTGGTCCCATCAAG Chr2:30191923..30191942 59.93 45
downstream ENSMUSE00000511818 Chr2:30192162..30192247 CCACTGGCGTAGGAGGATAA Chr2:30192245..30192264 60.09 55
downstream ENSMUSE00000696436 Chr2:30192162..30192247 CCACTGGCGTAGGAGGATAA Chr2:30192245..30192264 60.09 55
downstream ENSMUSE00000510877 Chr2:30192452..30192597 TCGCAGCTCCTTCATCTGTA Chr2:30192599..30192618 59.7 50
downstream ENSMUSE00000696435 Chr2:30192452..30192597 TCGCAGCTCCTTCATCTGTA Chr2:30192599..30192618 59.7 50
downstream ENSMUSE00000359163 Chr2:30192744..30192925 CTGTCTCCATGCTGTCCTTG Chr2:30192887..30192906 59.42 55
downstream ENSMUSE00000163634 Chr2:30195019..30195219 AGCTCCTTAGCCAGATGCAG Chr2:30195056..30195075 59.74 55
downstream ENSMUSE00000284610 Chr2:30195336..30195428 ACACTCAAGAGGGGCAAACA Chr2:30195400..30195419 60.69 50
downstream ENSMUSE00000284602 Chr2:30196109..30196267 GCCTCCGTCAGGAAATTGTA Chr2:30196230..30196249 60.07 50
downstream ENSMUSE00000284545 Chr2:30197212..30197349 ACGGTGTGATCTGCTTCCTC Chr2:30197276..30197295 60.27 55
downstream ENSMUSE00000284540 Chr2:30197893..30197967 ACAGGCCTGGCACAAGTAAC Chr2:30197925..30197944 60.18 55
downstream ENSMUSE00000410273 Chr2:30198053..30198310 AGACATCCGGAGTGAAGTGG Chr2:30198293..30198312 60.11 55
downstream ENSMUSE00000284529 Chr2:30198442..30198573 GGGAGCCACTTCAGAGTCAA Chr2:30198522..30198541 60.39 55
downstream ENSMUSE00000696434 Chr2:30198483..30198494 No primer for this exon
downstream ENSMUSE00000284523 Chr2:30198795..30198868 TAATGTTCGGGTCCCTTCTG Chr2:30198869..30198888 59.93 50
downstream ENSMUSE00000284519 Chr2:30198981..30199110 GCTTGGGAGATGAGCAGGTA Chr2:30199037..30199056 60.36 55
downstream ENSMUSE00000387211 Chr2:30199222..30199782 TGCACAAGTTGGATCAGAGG Chr2:30199373..30199392 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGGCAGCGGTTGTTAGAA Chr2:30153965..30153985 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGGCAGCGGTTGTTAGAA Chr2:30153965..30153985 60.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052533