Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19468
Trapped Gene
5730427N09Rik (ENSMUSG00000060739)
Vector Insertion
Chr 13: 97905664 - 97907709
Public Clones 3SD182F09 (ggtc) IST14221C6 (tigm) IST14309B10 (tigm)
Private Clones OST390668 (lexicon) OST278662 (lexicon) OST238812 (lexicon) OST122798 (lexicon)
OST39011 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680299 (Chr13:97907710..97907821 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGACCAGTGACATCCAGA Chr13:97907770..97907789 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680299 (Chr13:97907710..97907821 -)
Downstram Exon
ENSMUSE00000484448 (Chr13:97905476..97905663 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGACCAGTGACATCCAGA Chr13:97907770..97907789 59.5 55 CCTCCCGACCTTCTTTCTTT Chr13:97905551..97905570 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680299 Chr13:97907710..97907821 GTGGACCAGTGACATCCAGA Chr13:97907770..97907789 59.5 55

*** Putative Vector Insertion (Chr 13: 97905664 - 97907709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000484448 Chr13:97905476..97905663 CCTCCCGACCTTCTTTCTTT Chr13:97905551..97905570 59.69 50
downstream ENSMUSE00000489199 Chr13:97905249..97905399 CAGATAGGCAGGGACTGCTC Chr13:97905299..97905318 59.97 60
downstream ENSMUSE00000680298 Chr13:97903580..97903673 GGCACGAACTTTGGGTAGAG Chr13:97903616..97903635 59.73 55
downstream ENSMUSE00000486116 Chr13:97903494..97903673 GGCACGAACTTTGGGTAGAG Chr13:97903616..97903635 59.73 55
downstream ENSMUSE00000680297 Chr13:97903111..97903130 No primer for this exon
downstream ENSMUSE00000483452 Chr13:97901798..97901990 GGGGACGATGGATTCTTTTT Chr13:97901874..97901893 60.13 45
downstream ENSMUSE00000640443 Chr13:97900953..97901183 TGCTTGATGACTGCACATGA Chr13:97900970..97900989 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCACTCGGCCTTCTTAAA Chr13:97907828..97907848 59.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCAGTGACATCCCGTGAC Chr13:97907765..97907785 61.45 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060739