Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19473
Trapped Gene
Arhgef6 (ENSMUSG00000031133)
Vector Insertion
Chr X: 54591514 - 54591907
Public Clones not available
Private Clones OST390613 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350465 (ChrX:54591515..54591906 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCCAGAAGAACGCCTTG ChrX:54591658..54591677 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350465 (ChrX:54591515..54591906 -)
Downstram Exon
ENSMUSE00000719926 (ChrX:54591515..54591906 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCCAGAAGAACGCCTTG ChrX:54591658..54591677 59.81 50 CAAGGCGTTCTTCTGGATTC ChrX:54591636..54591655 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350465 ChrX:54591515..54591906 GAATCCAGAAGAACGCCTTG ChrX:54591658..54591677 59.81 50
upstream ENSMUSE00000719926 ChrX:54591515..54591906 GAATCCAGAAGAACGCCTTG ChrX:54591658..54591677 59.81 50

*** Putative Vector Insertion (Chr X: 54591514 - 54591907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391083 ChrX:54590129..54590212 CATTGATGTTGTCGATGCAG ChrX:54590142..54590161 58.65 45
downstream ENSMUSE00000357569 ChrX:54557743..54557827 CCCCGAATAGAGGTCATCAG ChrX:54557776..54557795 59.5 55
downstream ENSMUSE00000345830 ChrX:54555487..54555608 TGGTCGCAGCACTAAGAGAA ChrX:54555533..54555552 59.74 50
downstream ENSMUSE00000553682 ChrX:54552637..54552838 CACCAGCCTCCTTCTTCAAC ChrX:54552683..54552702 59.84 55
downstream ENSMUSE00000206693 ChrX:54542398..54542468 TGGAGCAGTGTCAAATCCTTT ChrX:54542400..54542420 59.73 42.86
downstream ENSMUSE00000700401 ChrX:54534669..54534680 No primer for this exon
downstream ENSMUSE00000206680 ChrX:54533389..54533483 No primer for this exon
downstream ENSMUSE00000206685 ChrX:54529055..54529150 GCTTGGCAGAGTGTCTGTTG ChrX:54529051..54529070 59.62 55
downstream ENSMUSE00000206686 ChrX:54527072..54527194 GAGCACGTTGACAGCTGATG ChrX:54527061..54527080 60.63 55
downstream ENSMUSE00000313445 ChrX:54509298..54509436 GCTGGATGCACCTTGATTTT ChrX:54509372..54509391 60.08 45
downstream ENSMUSE00000313440 ChrX:54504467..54504526 CCTGATGGTCTGGATGAGTG ChrX:54504483..54504502 59.05 55
downstream ENSMUSE00000206683 ChrX:54502140..54502286 TCCCATGCCTGAATAGGTTC ChrX:54502191..54502210 59.89 50
downstream ENSMUSE00000206691 ChrX:54499564..54499650 ACTCATCCGAGGACTTGCAG ChrX:54499557..54499576 60.41 55
downstream ENSMUSE00000206694 ChrX:54498729..54498807 TGCCTTCAATTTCATCCAATC ChrX:54498731..54498751 59.89 38.1
downstream ENSMUSE00000395977 ChrX:54497782..54497927 TTGTTGCAATGGACCACAAT ChrX:54497869..54497888 59.82 40
downstream ENSMUSE00000373832 ChrX:54496567..54496692 AGTGGAGGTGCAGGTCGTAG ChrX:54496576..54496595 60.32 60
downstream ENSMUSE00000700402 ChrX:54494983..54495003 No primer for this exon
downstream ENSMUSE00000341177 ChrX:54493771..54493864 CGTATTCTTCCTCGGATGCT ChrX:54493761..54493780 59.29 50
downstream ENSMUSE00000206678 ChrX:54492343..54492420 TGCAATAAGCTTCGATCACC ChrX:54492342..54492361 58.87 45
downstream ENSMUSE00000206692 ChrX:54490163..54490262 TCCTCGGGGAGTAGAACTTG ChrX:54490198..54490217 59.28 55
downstream ENSMUSE00000206679 ChrX:54488034..54488088 No primer for this exon
downstream ENSMUSE00000342580 ChrX:54484664..54486828 GTAAAGGGCTGTTGGGCATA ChrX:54486394..54486413 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATCCGTGACTGGGAAAAC ChrX:54591841..54591861 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031133