Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1949
Trapped Gene
Vps13b (ENSMUSG00000037646)
Vector Insertion
Chr 15: 35604708 - 35638880
Public Clones CC0347 (sanger) AH0253 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000624148 (Chr15:35604564..35604707 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGATTGGAGCCATCAAC Chr15:35604675..35604694 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000624148 (Chr15:35604564..35604707 +)
Downstram Exon
ENSMUSE00000624147 (Chr15:35638881..35639568 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGATTGGAGCCATCAAC Chr15:35604675..35604694 59.93 50 TTGTCTGGCAGATGACCTTG Chr15:35639381..35639400 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418943 Chr15:35301304..35301532 TCTGTGGCGTGTTTACCTTG Chr15:35301324..35301343 59.76 50
upstream ENSMUSE00000235032 Chr15:35301688..35301862 GGACGTGGTTCTCAGCAAAC Chr15:35301814..35301833 60.7 55
upstream ENSMUSE00000235026 Chr15:35308644..35308787 TGGCCATATCCATGAACTGA Chr15:35308673..35308692 59.88 45
upstream ENSMUSE00000235019 Chr15:35347266..35347386 CATCCATAAAACCCCGAAGA Chr15:35347327..35347346 59.76 45
upstream ENSMUSE00000624171 Chr15:35352063..35352230 GTGGGTGAGTTATGGGATCG Chr15:35352191..35352210 60.19 55
upstream ENSMUSE00000624170 Chr15:35352871..35353052 CAACTGATCTGGTGCTGAGG Chr15:35352871..35352890 59.42 55
upstream ENSMUSE00000624169 Chr15:35359865..35360039 TAATGCAGCTTGGGATTGCT Chr15:35359932..35359951 60.74 45
upstream ENSMUSE00000624168 Chr15:35368468..35368733 TTATTGCACAAAGGCGACTG Chr15:35368703..35368722 59.87 45
upstream ENSMUSE00000624167 Chr15:35375325..35375420 TTTGTGTTGGGAACAAGAAGG Chr15:35375387..35375407 59.99 42.86
upstream ENSMUSE00000624166 Chr15:35375793..35375915 TGTAGGTTGCAGAGCCATGT Chr15:35375837..35375856 59.32 50
upstream ENSMUSE00000624165 Chr15:35376378..35376515 TGGATGCAGCTCACCATAAG Chr15:35376496..35376515 59.82 50
upstream ENSMUSE00000624164 Chr15:35377440..35377527 ACAGAGGTTTGGTGCGTTTT Chr15:35377466..35377485 59.64 45
upstream ENSMUSE00000624163 Chr15:35378285..35378476 TCTAGATTGCCGTCTGGACA Chr15:35378376..35378395 59.39 50
upstream ENSMUSE00000624162 Chr15:35381853..35382022 CAGTACTGGATCCCGAGGAA Chr15:35381874..35381893 60.06 55
upstream ENSMUSE00000371182 Chr15:35384712..35384906 TCGAGTAACGTCACGAATGC Chr15:35384715..35384734 59.87 50
upstream ENSMUSE00000395644 Chr15:35386370..35386494 TGCACCAATTATCCCCTCTT Chr15:35386429..35386448 59.39 45
upstream ENSMUSE00000483848 Chr15:35401638..35401819 TTGAGCTCCCAAATCTCACA Chr15:35401676..35401695 59.37 45
upstream ENSMUSE00000624161 Chr15:35463051..35463185 AAGAATCCCCTGCCAACTCT Chr15:35463062..35463081 60.07 50
upstream ENSMUSE00000624160 Chr15:35463942..35464115 AAGCCCGAATCTCTCCTAGC Chr15:35464034..35464053 59.95 55
upstream ENSMUSE00000624159 Chr15:35501815..35501924 CAACCACAGAAACGAGCAAA Chr15:35501889..35501908 59.88 45
upstream ENSMUSE00000624158 Chr15:35506134..35506281 GCCTCAGAATATGCCAGCAG Chr15:35506236..35506255 60.9 55
upstream ENSMUSE00000356638 Chr15:35506194..35506281 GCCTCAGAATATGCCAGCAG Chr15:35506236..35506255 60.9 55
upstream ENSMUSE00000234924 Chr15:35527150..35527277 TCCAGACCAGTGTCAGTTCCT Chr15:35527152..35527172 59.74 52.38
upstream ENSMUSE00000624157 Chr15:35527150..35527277 TCCAGACCAGTGTCAGTTCCT Chr15:35527152..35527172 59.74 52.38
upstream ENSMUSE00000125242 Chr15:35536885..35537119 CTGCAGGAGATTCCGTTTGT Chr15:35537074..35537093 60.26 50
upstream ENSMUSE00000125244 Chr15:35547353..35547573 TCCTTGGACCATAAGCTTGC Chr15:35547363..35547382 60.21 50
upstream ENSMUSE00000125243 Chr15:35553357..35553560 CAGTTTGGAGCAGCGTAGGT Chr15:35553481..35553500 60.45 55
upstream ENSMUSE00000125249 Chr15:35569608..35569779 GGCCGTGTTAGTCTGTGGAT Chr15:35569695..35569714 60 55
upstream ENSMUSE00000125247 Chr15:35570285..35570399 CCATAGACGTGCAGGATGTG Chr15:35570324..35570343 60.14 55
upstream ENSMUSE00000234905 Chr15:35572153..35572219 GGTTGGCAGTCAGGACATTT Chr15:35572163..35572182 59.97 50
upstream ENSMUSE00000234901 Chr15:35572601..35572651 No primer for this exon
upstream ENSMUSE00000624156 Chr15:35572814..35572838 No primer for this exon
upstream ENSMUSE00000624155 Chr15:35572841..35572867 GAGGTGCCTTCCTTTCCTGT Chr15:35572842..35572861 60.63 55
upstream ENSMUSE00000624154 Chr15:35572871..35572918 TTGTTGGTTCGACCCCTTAG Chr15:35572886..35572905 59.96 50
upstream ENSMUSE00000624153 Chr15:35572922..35572948 TGTCCTGCCTTCCTTTCTTC Chr15:35572928..35572947 59.4 50
upstream ENSMUSE00000624152 Chr15:35575728..35576136 CGCTGACTTCACGCAATTTA Chr15:35576041..35576060 60.01 45
upstream ENSMUSE00000624151 Chr15:35582010..35582121 TGGCTCCTCAGGCTGATAAT Chr15:35582064..35582083 59.8 50
upstream ENSMUSE00000624150 Chr15:35598456..35598659 CACTGCTCAGTGGGATCAAC Chr15:35598546..35598565 59.26 55
upstream ENSMUSE00000624149 Chr15:35601054..35601180 CTGTGCGAATAACTGGAGCA Chr15:35601110..35601129 60.01 50
upstream ENSMUSE00000624148 Chr15:35604564..35604707 ACTGGATTGGAGCCATCAAC Chr15:35604675..35604694 59.93 50

*** Putative Vector Insertion (Chr 15: 35604708 - 35638880) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624147 Chr15:35638881..35639568 TTGTCTGGCAGATGACCTTG Chr15:35639381..35639400 59.83 50
downstream ENSMUSE00000624146 Chr15:35675402..35675539 CTGCAGCCACACGATGTTAT Chr15:35675457..35675476 59.75 50
downstream ENSMUSE00000624145 Chr15:35700211..35700618 TAGAGTCTGACGGGGTGGAG Chr15:35700357..35700376 60.25 60
downstream ENSMUSE00000624144 Chr15:35721794..35721996 GGAGGAATGATGATCCAAGG Chr15:35721823..35721842 59.29 50
downstream ENSMUSE00000624143 Chr15:35723589..35723793 CTGATTCGGGTACTGGCATT Chr15:35723694..35723713 59.96 50
downstream ENSMUSE00000624142 Chr15:35724060..35724244 CGTGATTCGTACAAGGGTGA Chr15:35724181..35724200 59.57 50
downstream ENSMUSE00000427778 Chr15:35763939..35764135 ACGCAACAAAAACCTTCTGG Chr15:35763993..35764012 60.15 45
downstream ENSMUSE00000234730 Chr15:35769630..35769811 AGATGAGCGAACTGGAAGGA Chr15:35769773..35769792 59.95 50
downstream ENSMUSE00000234721 Chr15:35771004..35771353 TTCACCACAGTTTGCATCGT Chr15:35771208..35771227 60.16 45
downstream ENSMUSE00000234713 Chr15:35776601..35776762 TGGAGACTCGCCAAAAGAAT Chr15:35776725..35776744 59.81 45
downstream ENSMUSE00000234707 Chr15:35799042..35799197 TGAGTGCTCGGACTTTGATG Chr15:35799183..35799202 59.98 50
downstream ENSMUSE00000234701 Chr15:35805317..35805580 CTTGACCAGTCCTCGTCTCC Chr15:35805534..35805553 59.83 60
downstream ENSMUSE00000234693 Chr15:35806135..35806218 TCGCTGCTGAACTTGAGAGT Chr15:35806218..35806237 58.91 50
downstream ENSMUSE00000234684 Chr15:35806397..35806572 TCAGGTTCGACATTTTGCAG Chr15:35806545..35806564 59.84 45
downstream ENSMUSE00000234676 Chr15:35807252..35807422 GATATGGGAACCGCACAATC Chr15:35807293..35807312 60.16 50
downstream ENSMUSE00000234672 Chr15:35808398..35808599 TTGGGCTATCCCACTGACTC Chr15:35808432..35808451 60.07 55
downstream ENSMUSE00000234666 Chr15:35809524..35809712 GGGAAAGCTCCGAGTCTGAT Chr15:35809702..35809721 60.74 55
downstream ENSMUSE00000234659 Chr15:35812644..35812790 ATGACTTGTATGCCGTGCTG Chr15:35812696..35812715 59.75 50
downstream ENSMUSE00000234653 Chr15:35814262..35814545 AGTTCCAAAGGGCACTGCTA Chr15:35814522..35814541 59.88 50
downstream ENSMUSE00000234646 Chr15:35816632..35816759 TACTGGGCATCTGTTGTGGA Chr15:35816734..35816753 60.11 50
downstream ENSMUSE00000234638 Chr15:35816938..35817137 CCACTCGGCTGTCATTTCTT Chr15:35817104..35817123 60.26 50
downstream ENSMUSE00000234631 Chr15:35835027..35835145 TTCCGGGGCTAGAATGATAA Chr15:35835113..35835132 59.5 45
downstream ENSMUSE00000234624 Chr15:35839902..35840704 CAAAGGTGAACTCGCTGACA Chr15:35840338..35840357 60.03 50
downstream ENSMUSE00000234619 Chr15:35844529..35844705 GTGCTTGACGAATGATGTGG Chr15:35844698..35844717 60.12 50
downstream ENSMUSE00000234615 Chr15:35846802..35846972 CGGTTGTAGTGCTCCTCGTC Chr15:35846889..35846908 60.85 60
downstream ENSMUSE00000234608 Chr15:35852942..35853118 TGGTGAATACCCCCATGATT Chr15:35853076..35853095 59.87 45
downstream ENSMUSE00000234602 Chr15:35855059..35855161 TATTTGACGTGGCTGTTTGG Chr15:35855158..35855177 59.58 45
downstream ENSMUSE00000234597 Chr15:35855796..35856045 TTCTGATGTCAGCAGCAAGC Chr15:35855907..35855926 60.3 50
downstream ENSMUSE00000624141 Chr15:35859610..35859849 GTGGGTCCACCAAATAATGG Chr15:35859787..35859806 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTCCTAATCGCCTTGCAG Chr15:35628753..35628773 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACTGCACGTTTCGTGACT Chr15:35628746..35628766 60.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037646