Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19491
Trapped Gene
Hmga2 (ENSMUSG00000056758)
Vector Insertion
Chr 10: 119899771 - 119910307
Public Clones not available
Private Clones OST390298 (lexicon) OST302125 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000395416 (Chr10:119910308..119910394 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAAGGCAGCAAAAACAAG Chr10:119910332..119910351 60.77 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000395416 (Chr10:119910308..119910394 -)
Downstram Exon
ENSMUSE00000573669 (Chr10:119899720..119899770 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAAGGCAGCAAAAACAAG Chr10:119910332..119910351 60.77 45 TTCCTAGGTCTGCCTCTTGG Chr10:119899702..119899721 59.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639940 Chr10:119913009..119913344 CAGCCTAAGCAGCAGCAGTA Chr10:119913284..119913303 59.54 55
upstream ENSMUSE00000395416 Chr10:119910308..119910394 CCAAAGGCAGCAAAAACAAG Chr10:119910332..119910351 60.77 45

*** Putative Vector Insertion (Chr 10: 119899771 - 119910307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573669 Chr10:119899720..119899770 TTCCTAGGTCTGCCTCTTGG Chr10:119899702..119899721 59.42 55
downstream ENSMUSE00000665541 Chr10:119811724..119811756 GCAGGCTTCTTCTGAACGAC Chr10:119811706..119811725 60.14 55
downstream ENSMUSE00000665540 Chr10:119800334..119801352 GGTGGGTTCATTGGGTACTG Chr10:119800376..119800395 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTTAATCTATGGCTGGA Chr10:119904318..119904338 58.04 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTTAATCTATGGCTGGA Chr10:119904318..119904338 58.04 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056758