Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19497
Trapped Gene
1810046J19Rik (ENSMUSG00000002580)
Vector Insertion
Chr 11: 98299628 - 98299960
Public Clones not available
Private Clones OST390176 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111436 (Chr11:98299961..98300058 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111436 (Chr11:98299961..98300058 -)
Downstram Exon
ENSMUSE00000281887 (Chr11:98299551..98299627 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000281896 Chr11:98300172..98300284 No primer for this exon
upstream ENSMUSE00000111436 Chr11:98299961..98300058 No primer for this exon

*** Putative Vector Insertion (Chr 11: 98299628 - 98299960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000281887 Chr11:98299551..98299627 No primer for this exon
downstream ENSMUSE00000405327 Chr11:98299037..98299459 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACCTGCTGAGTCAGTCC Chr11:98299926..98299946 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACCTGCTGAGTCAGTCC Chr11:98299926..98299946 60.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002580