Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19504
Trapped Gene
Gins1 (ENSMUSG00000027454)
Vector Insertion
Chr 2: 150735530 - 150738516
Public Clones not available
Private Clones OST390056 (lexicon) OST353690 (lexicon) OST347217 (lexicon) OST320735 (lexicon)
OST305116 (lexicon) OST277662 (lexicon) OST165061 (lexicon) OST59137 (lexicon)
OST52787 (lexicon) OST39833 (lexicon) OST39830 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169711 (Chr2:150735337..150735529 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTGTCCGCGAGTTACAC Chr2:150735477..150735496 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169711 (Chr2:150735337..150735529 +)
Downstram Exon
ENSMUSE00000169710 (Chr2:150738517..150738581 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTGTCCGCGAGTTACAC Chr2:150735477..150735496 60.46 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000169711 Chr2:150735337..150735529 AGCTTGTCCGCGAGTTACAC Chr2:150735477..150735496 60.46 55

*** Putative Vector Insertion (Chr 2: 150735530 - 150738516) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169710 Chr2:150738517..150738581 No primer for this exon
downstream ENSMUSE00000169709 Chr2:150741872..150741970 GTATCAGATCCCCTCGTCCA Chr2:150741912..150741931 59.89 55
downstream ENSMUSE00000286041 Chr2:150743605..150743695 CCCATATTCCCACCTGAGTG Chr2:150743653..150743672 60.19 55
downstream ENSMUSE00000385793 Chr2:150751618..150751734 GTGTGATGTCCAAGCCTTCA Chr2:150751702..150751721 59.68 50
downstream ENSMUSE00000595309 Chr2:150753778..150753852 AGCAGGACTGAAGTGCCATC Chr2:150753839..150753858 60.42 55
downstream ENSMUSE00000595308 Chr2:150756577..150757014 TCCAGTGAGGACGTTTCCTT Chr2:150756718..150756737 59.7 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAGTAATCGCCTTGCAG Chr2:150735512..150735532 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAGCGTGACTGGGAAAAC Chr2:150735513..150735533 61.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027454