Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19507
Trapped Gene
Ccdc76 (ENSMUSG00000033439)
Vector Insertion
Chr 3: 116298512 - 116316676
Public Clones (sanger) (sanger) IST14284D6 (tigm) IST12364H8 (tigm) IST13398C4 (tigm)
IST12970G2 (tigm) IST14113B3 (tigm) IST12026B4 (tigm) IST13398C4 (tigm)
Private Clones OST389965 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000443078 (Chr3:116316677..116317505 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGGATATTCCGTTGATGG Chr3:116316880..116316899 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000443078 (Chr3:116316677..116317505 -)
Downstram Exon
ENSMUSE00000401219 (Chr3:116297557..116298511 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGGATATTCCGTTGATGG Chr3:116316880..116316899 60.01 50 CCCTGCGGACTTAATGGATA Chr3:116298198..116298217 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000443078 Chr3:116316677..116317505 GGTGGATATTCCGTTGATGG Chr3:116316880..116316899 60.01 50

*** Putative Vector Insertion (Chr 3: 116298512 - 116316676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401219 Chr3:116297557..116298511 CCCTGCGGACTTAATGGATA Chr3:116298198..116298217 59.92 50
downstream ENSMUSE00000324552 Chr3:116295382..116295428 No primer for this exon
downstream ENSMUSE00000324543 Chr3:116295111..116295177 No primer for this exon
downstream ENSMUSE00000324533 Chr3:116293148..116293210 TTGCTCAGGAATCTCTGTTTCA Chr3:116293129..116293150 59.99 40.91
downstream ENSMUSE00000324527 Chr3:116292652..116292721 No primer for this exon
downstream ENSMUSE00000324518 Chr3:116292409..116292515 TCATTAAGGGCATCATGCAA Chr3:116292430..116292449 60.03 40
downstream ENSMUSE00000324508 Chr3:116291390..116291557 TTCCTGCTCCAAACTCAACA Chr3:116291460..116291479 59.42 45
downstream ENSMUSE00000324497 Chr3:116288673..116288745 AAGCCTTTCAAACACTGAGTCC Chr3:116288679..116288700 59.79 45.46
downstream ENSMUSE00000324490 Chr3:116288114..116288188 CAGGTGCTTCCCAATTCCTA Chr3:116288108..116288127 60.07 50
downstream ENSMUSE00000324481 Chr3:116285412..116285841 CTCCATCATCGTGCTCTTCA Chr3:116285430..116285449 59.94 50
downstream ENSMUSE00000353072 Chr3:116284254..116284528 TGATGTTTTTCCTGCGATGA Chr3:116284315..116284334 60.2 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTAATCGCCTTGCAGCAC Chr3:116307608..116307628 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATAAACACACAAAAACAATTT Chr3:116304681..116304705 59.27 29.17 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGAAGAGGTGCAAAGAGTG Chr3:116305482..116305502 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGAAGAGGTGCAAAGAGTG Chr3:116305482..116305502 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033439