Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19508
Trapped Gene
Atp6ap1 (ENSMUSG00000019087)
Vector Insertion
Chr X: 71542661 - 71542961
Public Clones not available
Private Clones OST389963 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698386 (ChrX:71542518..71542660 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698386 (ChrX:71542518..71542660 +)
Downstram Exon
ENSMUSE00000698384 (ChrX:71542962..71543088 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361867 ChrX:71542486..71542660 No primer for this exon
upstream ENSMUSE00000698386 ChrX:71542518..71542660 No primer for this exon

*** Putative Vector Insertion (Chr X: 71542661 - 71542961) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209165 ChrX:71542962..71543088 No primer for this exon
downstream ENSMUSE00000698384 ChrX:71542962..71543088 No primer for this exon
downstream ENSMUSE00000209163 ChrX:71545589..71545663 No primer for this exon
downstream ENSMUSE00000698383 ChrX:71545589..71545663 No primer for this exon
downstream ENSMUSE00000209159 ChrX:71545917..71546110 No primer for this exon
downstream ENSMUSE00000698380 ChrX:71545917..71546110 No primer for this exon
downstream ENSMUSE00000209166 ChrX:71546663..71546703 No primer for this exon
downstream ENSMUSE00000698377 ChrX:71546663..71546703 No primer for this exon
downstream ENSMUSE00000209164 ChrX:71547275..71547360 No primer for this exon
downstream ENSMUSE00000698376 ChrX:71547275..71547360 No primer for this exon
downstream ENSMUSE00000209158 ChrX:71547701..71547939 No primer for this exon
downstream ENSMUSE00000698373 ChrX:71547701..71547939 No primer for this exon
downstream ENSMUSE00000209167 ChrX:71548561..71548608 No primer for this exon
downstream ENSMUSE00000698370 ChrX:71548561..71548608 No primer for this exon
downstream ENSMUSE00000209161 ChrX:71548697..71548925 No primer for this exon
downstream ENSMUSE00000698366 ChrX:71548697..71548925 No primer for this exon
downstream ENSMUSE00000698365 ChrX:71548986..71549051 No primer for this exon
downstream ENSMUSE00000698390 ChrX:71549070..71549135 No primer for this exon
downstream ENSMUSE00000354479 ChrX:71549136..71550029 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCTTGGCTGAGTTGTAAT ChrX:71542696..71542716 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTGGTACTGTGGTCGAG ChrX:71542636..71542656 59.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019087