Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19512
Trapped Gene
Tcea2 (ENSMUSG00000059540)
Vector Insertion
Chr 2: 181415181 - 181417917
Public Clones not available
Private Clones OST389895 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000545358 (Chr2:181415022..181415180 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCTGGACAAAATGGTGAC Chr2:181415148..181415167 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000545358 (Chr2:181415022..181415180 +)
Downstram Exon
ENSMUSE00000170854 (Chr2:181417918..181417980 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCTGGACAAAATGGTGAC Chr2:181415148..181415167 59.97 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545358 Chr2:181415022..181415180 AGGCTGGACAAAATGGTGAC Chr2:181415148..181415167 59.97 50

*** Putative Vector Insertion (Chr 2: 181415181 - 181417917) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170854 Chr2:181417918..181417980 No primer for this exon
downstream ENSMUSE00000590884 Chr2:181418253..181418358 CGCAGAGCATTGACAGACAT Chr2:181418290..181418309 60.02 50
downstream ENSMUSE00000170864 Chr2:181419148..181419238 TGGATTTGCCATCAGAAACA Chr2:181419171..181419190 60.05 40
downstream ENSMUSE00000170863 Chr2:181420497..181420627 AGCATCTCTCGGCATTTGTT Chr2:181420607..181420626 59.84 45
downstream ENSMUSE00000661104 Chr2:181420895..181420951 GATGCTCACAGTTCACACCAA Chr2:181420932..181420952 59.74 47.62
downstream ENSMUSE00000661103 Chr2:181421303..181421457 CGCACCCGATTCTTGTACTT Chr2:181421357..181421376 60.13 50
downstream ENSMUSE00000590883 Chr2:181421533..181421679 CGAATCTCCTTCAGCTCGTC Chr2:181421567..181421586 60.1 55
downstream ENSMUSE00000545341 Chr2:181422319..181422390 CTTCCATCGATTCCCACACT Chr2:181422393..181422412 59.93 50
downstream ENSMUSE00000401942 Chr2:181422582..181422764 GGTTACGTCAGAAGGGCTCA Chr2:181422610..181422629 60.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000059540